Ethics statement
Animal studies were conducted following the guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (Approval No. XJ24001, XJ23002, XJ23005, BSYYF20220903006). The animals were housed and cared for at the facility accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care. All procedures involving animals were conducted under anesthesia with 2% isoflurane (for mice) or 5 mg/kg zoletil 50 (for monkeys) prior to sample collection to ensure their well-being, and every effort was made to minimize any potential animal suffering.
Cells and viruses
Vero E6 (ATCC, CRL-1586) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO) supplemented with 10% or 2% heat-inactivated fetal bovine serum (FBS, GIBCO), 100 units/ml penicillin and 100 units/ml streptomycin, and the cells were grown at 37 °C under an atmosphere with 5% CO2.
Mpox virus Clade IIb (MPXV-B.1-China-C-Tan-CQ01) were isolated from first imported mpox case of mainland China in 202242. Vaccina virus Western Reverse strain (VACV WR) were kindly provided by Min Fang (Institute of Microbiology, Chinese Academy of Sciences, Beijing, China). Viruses were cultivated in Vero cells and titrated via plaque assay as described previously42. All procedures were performed in a BSL-3 containment facility at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences.
Mice study
Six- to eight-week-old BALB/c mice (female) were purchased from obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., and four- to eight-week-old CAST/EiJ mice (6 males and 6 females) were obtained from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences. All mice were confirmed to be negative for MPXV and VACV prior to the experiments, and housed in small ventilated microisolator cages under pathogen-free conditions. The environment was temperature-controlled (21-23 °C) with a 12 h light and dark cycle, 50–60% relative humidity, and free access to food and water. The experiments involving the challenge of CAST/EiJ mice with MPXV clade IIb strain in this study were conducted in an animal biosafety level 3 (ABSL-3) containment facility at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences.
The protective efficacy of NTV prime-boost immunization was evaluated against VACV challenge in BALB/c mice and MPXV challenge in CAST/EiJ mice. On day 0, mice received a prime immunization followed by a booster dose on day 28, administered intramuscularly, with either 1 dose NTV (1 × 108 PFU) or a sham saline treatment. Following 14 days after the boost immunization, the mice were inoculated with a 1 × 106 TCID50 dose of VACV WR strain via the intranasal route or a 1 × 106 TCID50 dose of MPXV clade IIb strain via the intraperitoneal route. Mice were monitored over the designated period for disease symptoms, including weight loss, survival, and viral loads and titers in tissues.
For the above mice immunization and infection, mice were anesthetized with 2% isoflurane. At the end of the experiments, mice were euthanized using 2% isoflurane, followed by cervical dislocation.
Rabbit study
Ninety- to one hundred-day-old rabbits (female) were obtained from Beijing Fuhao Experimental Animal Breeding Center. All rabbit were confirmed to be negative for MPXV and VACV prior to the experiments. To evaluate the humoral immune response of NTV in rabbits, twenty-four rabbits were randomly divided into four groups (n = 6/group), and inoculated with NTV (1 × 108 PFU) or TTV (1 × 106 PFU) via intramuscular route. Blood samples were collected on days 7, 14 and 21 after the final NTV immunization or on days 21, 28 and 35 after TTV immunization, and the levels of binding antibodies and neutralizing antibodies were measured.
Nonhuman primate studies
In this study, sixty-six nonhuman primates, including thirty-six rhesus macaques (18 males and 18 females, 3.0-5.0 years old) and thirty cynomolgus monkeys (15 males and 15 females, 3.1-3.6 years old), were confirmed to be negative for MPXV and VACV prior to the experiments. Basic information of nonhuman primates used in this study is presented in Supplementary Tables 1–3.
Study I, protective efficacy of NTV prime-boost immunization against MPXV challenge in rhesus macaques. Twenty-four rhesus macaques were divided into four groups (1/5 dose NTV: 2 × 107 PFU; 1 dose NTV: 1 × 108 PFU; 2 doses NTV: 2 × 108 PFU; sham control). On day 0, macaques received either a prime immunization followed by a boost on day 28 with different doses NTV or sham saline treatment via intramuscular route. After day 21 of boost immunization, twenty-four rhesus macaques were inoculated with 4 × 107 TCID50 dose of clade IIb MPXV (MPXV-B.1-China-C-Tan-CQ01) via the intravenous route and monitored for 10 days (3 euthanized in each group) and 28 days (3 euthanized in each group) for disease symptoms, including weight loss, body temperature, lesions, neutralizing antibody, plasma and tissues loads. Plasma viral loads and skin lesions reached their peak at 10 days post MPXV challenge and recovered by 28 days post-challenge in our previously completed study, which was consistent with previous reports19,24,25. Based on this, we selected 10 days and 28 days post-challenge as the experimental endpoints for our study.
Study II, protective efficacy of NTV single-dose immunization and long-lasting immunization against MPXV challenge in rhesus macaques. For long-lasting protection assay, four rhesus macaques were inoculated with different doses of NTV (1/5 dose NTV, n = 1; 1 dose NTV, n = 1; 2 doses NTV, n = 2) via i.m. route (collectively known as the long-lasting immunization group), 4 × 107 TCID50 of MPXV was administered at eight months post immunization, and the long-lasting protection of NTV vaccine was evaluated by observation of skin lesions and plasma viral loads. For single-dose protection assay, eight rhesus macaques were randomized into two groups of four and immunized with single-dose of NTV or administered a saline control (single-dose immunization group and control group). The animals were administered 4 × 107 TCID50 of MPXV at 28 days post immunization and monitored for another 28 days.
Study III, safety evaluation of NTV in cynomolgus macaques. Thirty cynomolgus monkeys (15/gender) were divided into three groups (5/gender/group) and intramuscularly immunized with saline control, 1 or 3 doses of NTV three times, with 21-day intervals between each vaccination. Three of the five animals of each sex in each group were dissected on day 45, and remaining 2/5 animals of each sex in each group were dissected on day 70. Collection of data on safety-related parameters and clinical observation, including viral absorption kinetics, viral shedding, viral biodistribution, blood pressure, oxygen saturation, hematology, cytokine expression, and histopathology were carried out during and after immunization.
For immunization, blood collection, and infection procedures, the macaques were anesthetized with Zoletil 50 (5 mg/kg). Euthanasia was conducted by bloodletting through the femoral artery under the condition of zoletil 50 anesthesia (5 mg/kg).
Measurement of skin lesions
Skin lesion assessments were performed with the experimental operator blinded to the rhesus macaque group assignments. Lesion counts were conducted by one individual and independently verified by a second observer. Rhesus macaques were anesthetized with Zoletil-50 (5 mg/kg), and evaluations were carried out in a biosafety cabinet. Lesions, including erythema, papules, nodules, blisters, and pustules, were quantified across the entire body, encompassing both haired and non-haired regions. In cases of confluent lesions, individual pock boundaries remained discernible, allowing accurate enumeration of each pock within the confluent areas without merging into a continuous mass. Disease severity was classified into four grades based on lesion counts, following established criteria21: mild (1-25), moderate (26-100), severe (101-250, grave), and serious (>250, plus grave).
Enzyme-linked immunosorbent assay (ELISA)
IgG antibody titers in the sera samples were determined by ELISA. Briefly, 96-well plates were coated with NTV (105 PFU/well) or 1 μg/ml of A35R (40886-V08H, Sino Biological), B6R (40902-V08H, Sino Biological), H3L (40893-V08H1, Sino Biological), M1R (40904-V07H, Sino Biological), respectively and incubated overnight at 4°C. After incubation, the plates were washed three times with 300 μl/well 1×PBST and blocked with 1% BSA (200 μl/well) for 2 h at 37°C. Then, the plates were washed three times with 300 μl/well 1×PBST. Next, 3-fold gradient dilutions of inactivated serum samples starting at 1: 100 was added to blocked 96-well plates (100 μl/well), and incubated for 1 h at 37 °C. After washed three times with 300 μl/well 1×PBST, the plates were treated with 100 μl horseradish peroxidase (HRP)-conjugated goat anti-monkey IgG, goat anti-rabbit IgG, or rabbit anti-mouse IgG (Abcam, 1: 5,000 dilution) for 1 h at 37 °C. The plates were washed three times with 300 μl/well 1×PBS-T and treated with 100 μl /well soluble TMB substrate (R&D, USA) for 15-30 min at room temperature in the dark. The reaction was terminated with stop solution (R&D, USA). Absorbance at 450/630 nm was recorded using SpectraMax iD5 multimode microplate reader (Molecular Devices, USA). The ELISA endpoint titers were defined as the highest reciprocal dilution of serum to given an absorbance greater than 2.1-fold of the background values.
Plaque reduction neutralization titer (PRNT) assay
The neutralizing antibodies titers in sera samples were determined by 50% plaque reduction neutralization test (PRNT50). Briefly, Vero E6 cells were seeded in 24-well plates and incubated overnight at 37 °C, 5% CO2 until the cells reached 90-100% confluency. On the day of cell seeding, serum samples were heat-inactivated at 56 °C for 30 min and used to generate a 2-fold dilution series in DMEM containing 2% FBS. The diluted serum samples were added to equal volume of VACV or MPXV (100 PFU/0.1 ml) in a 48-well plate and incubated for 1 h at 37 °C. Subsequently, 200 μl of each serum-virus mixture was added to Vero E6 cells and incubated for 1 h at 37 °C. One milliliter of 0.5% methylcellulose was added to each well and incubated at 37 °C for 2 days (VACV) or 3 days (MPXV) to plaque formation. Next, the plaques were fixed with 4% neutral buffered formaldehyde overnight and then stained with 0.4% crystal violet solution for the enumeration of the plaques. Neutralization end-point titers were calculated via point-to-point linear regression and based on the reciprocal dilution of the test serum that produced 50% plaque reduction compared to the virus only control via Reed-Muench method. All the work with infectious MPXV were performed in a BSL-3 containment facility.
ELISpot assay
Cellular immune responses in the NTV vaccinated mice were assessed using IFN-γ precoated ELISPOT kits (MabTech, 3321-2 A), according to the manufacturer’s protocol. Briefly, the plates were washed 4 times with PBS and blocked using RPMI 1640 containing 10% FBS (200 μl/well) and incubated for 30 min at room temperature. Immunized mouse splenocytes (200,000 cells/well) were stimulated with NTV (2 × 106 PFU/ml, 100 μl/well), 50 ng/ml phorbol myristate acetate (PMA) and 450 ng/ml ionomycin (Thermo Fisher) as positive control and RPMI 1640 media as negative control. Following incubation at 37 °C, 5% CO2 for 36 h, plates were washed with PBS 5 times and incubated with biotinylated anti-mouse IFN-γ antibody (0.1 μg/100 μl/well) for 2 h at room temperature. Wash the plates and incubate Streptavidin-ALP (1: 1000, 100 μl/well) for 1 h at room temperature. Finally, the plates were incubated with BCIP/NBT-plus substrate solution until spots exposed on the plates. Wash the plates with deionized water and dry in a dark place for 24 h. The spots were read by an automated Mabtech IRIS ELISPOT reader (Mabtech). The numbers of spot-forming cells (SFU) per 0.2 million cells were calculated by vSpot 7.0 software.
Flow cytometry
CD4+ and CD8+ T cell responses were quantitated by vaccine (NTV) or virus (VACV)-stimulated intracellular cytokine staining (ICS) assays. 1 × 106 peripheral blood mononuclear cells (PBMCs) were re-suspended in 100 μl of RPMI 1640 media supplemented with CD49d and CD28 monoclonal antibody (BD Biosciences, 1 μg/mL each). Each sample was assessed with mock (100 μl of R10; background control), vaccina (NTV) or virus (VACV) (1 × 107 PFU/ml, 100 μl/well), or 50 ng/ml PMA and 450 ng/ml ionomycin (Thermo Fisher) (100 μl; positive control) and incubated for 3 h at 37 °C with 5% CO2. Subsequently cells were incubated with 10 μl of BFA (sigma) in 100 μl of R10 for additional 15 h. After incubation, the cells were washed twice with wash buffer (PBS with 0.5% FBS). Cells were first labeled using Fixable Viability Dye (invitrogen) for 20 min at room temperature to exclude dead cells and then stained with surface markers anti-CD3-BV650 (563916, BD Bioscience, 1: 50 dilution), anti-CD4-BV510 (317444, Biolegend, 1: 50 dilution), anti-CD8-BUV737 (612754, BD Bioscience, 1: 50 dilution) for 30 min. Cells were then fixed and permeabilized with the Cytofix/Cytoperm kit (BD Bioscience) and stained with anti-IFN-γ-AF700 (557995, BD Bioscience, 1: 250 dilution), anti-IL-2-PE (559334, BD Bioscience, 1: 50 dilution), anti-TNF-α-FITC (554512, BD Bioscience, 1: 250 dilution) for 30 min. Finally, cells were resuspended in FACS buffer for acquisition and analysis using a BD LSR Fortessa flow cytometer and the data were analyzed by FlowJo software (Version 10.1).
For measurement of the proportion of memory T cell subsets during long-lasting immunity, 1 × 106 PBMCs were first labeled using Fixable Viability Dye (invitrogen) for 20 min at room temperature to exclude dead cells and then stained with surface markers anti-CD3-BV650 (563916, BD Bioscience, 1: 50 dilution), anti-CD4-BV510 (317444, Biolegend, 1: 50 dilution), anti-CD8-BUV737 (612754, BD Bioscience, 1: 50 dilution), anti-CD45RA-BV711 (740806, BD Bioscience, 1: 100 dilution), anti-CCR7-BV605 (353224, Biolegend, 1: 50 dilution) for 30 min. Cells were resuspended in FACS buffer for acquisition and analysis using a BD LSR Fortessa flow cytometer and the data were analyzed by FlowJo software (Version 10.1).
Quantification of viral DNA
Viral DNA from plasma and tissues were assessed by quantitative PCR (qPCR) assay following a previously described method43,44. Briefly, viral DNA was extracted and purified using a DNeasy Blood & Tissue Kit (QIAGEN). Quantitative PCR was carried out on an ABI 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA) via TaqMan Gene Expression Master Mix (Applied Biosystems) using the following cycling protocol and primers: 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The sequences of the primers and probes were targeted against the conserved region F3L as follows43: 5′- CTCATTGATTTTTCGCGGGATA-3′ (forward), 5′- GACGATACTCCTCCTCGTTGGT-3′ (reverse), and 5′-(FAM)- CATCAGAATCTGTAGGCCGT-(MGB)-3′ (probe). The detection limit for viral DNA in the plasma was 100 copies/ml, and that for viral DNA in tissues was 10 copies/μg of total DNA.
Viral absorption kinetics and viral shedding
Blood samples with EDTA anticoagulant were collected from cynomolgus monkeys infected with varying doses of NTV (normal saline, 1 and 3 doses) at 0, 2, 24, 72 and 168 h after the prime (day 0) and boost-2 (day 42) immunizations. The viral absorption kinetics were assessed by measuring the vaccine DNA in the blood. Total DNA was extracted, and quantitative PCR was carried out via TaqMan Gene Expression Master Mix (Applied Biosystems) with region of E9L as follow: 5′- TGGCAAACCGTAACATACCG -3′ (forward), 5′- AGGCCATCTATGATTCCATGC -3′ (reverse), and 5′-(FAM)- ACGCTTCGGCTAAGAGTTGCACATCCA -(TRAMA)-3′ (probe). The PCR amplification conditions were set at 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Data were acquired by three independent replicate experiments.
Viral shedding was assessed by analyzing viral DNA loads in urine, feces, perioral secretions, perinasal secretions, and infection site swab in cynomolgus monkeys on days 0, 1, 3, 7, 43, 45, 49, 69 after immunization with different doses of NTV (saline, 1 dose and 3 doses). The methods for total DNA extraction and quantitative PCR are consistent with those described above.
Cytokine analysis
Sera samples were collected from 30 cynomolgus macaques on days −4, 0, 3, 42, 45, and 70 following prime immunization with varying doses of NTV (saline, 1 dose, and 3 doses). The samples were isolated from peripheral blood collected from each group. Using a Cytometric Bead Array (CBA) kit (BD Bioscience), the expression levels of TNF-α, IFN-γ, IL-2, IL-4, IL-5, and IL-6 in the serum were analyzed by flow cytometry (Beckman DxFLEX Flow Cytometer).
Hematology, clinical chemistry and antinuclear antibody
Blood samples with EDTA anticoagulant were collected on days −4, 3, 45, and 70 post-immunizations from cynomolgus monkeys treated with different doses of NTV (saline, 1 dose, and 3 doses). Hematological analysis was conducted using an automated hematology analyzer. The parameters measured included white blood cell count (WBC), hemoglobin (HGB), red blood cell count (RBC), platelet count (PLT), lymphocyte count (Lymph), lymphocyte ratio (Lymph%, the percentage of lymphocyte count in the white blood cell count), neutrophil count (Neut), neutrophil ratio (Neut%, the percentage of neutrophil count in the white blood cell count), monocyte count (Mono), and monocyte ratio (Mono%, the percentage of monocyte count in the white blood cell count).
Blood samples were collected on days −4, 45, and 70 from cynomolgus monkeys treated with different doses of NTV (saline, 1 dose, and 3 doses) into tubes containing Gel & Clot Activator. After centrifugation, clinical chemistry parameters were measured using a TBA-120FR automatic biochemical analyzer (TOSHIBA). The parameters included aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma-glutamyl transferase (GGT), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), total cholesterol (CHOL), blood urea nitrogen (BUN), creatinine (CREA), triglyceride (TGL), total bilirubin (TBI), and blood glucose (GLUC).
Blood samples were collected on days −4, 45, and 70 from cynomolgus monkeys treated with different doses of NTV (saline, 1 dose, and 3 doses) into tubes containing Gel & Clot Activator. After centrifugation, antinuclear antibody detection was performed using indirect immunofluorescence with an antinuclear antibody detection kit (Oumeng).
Histopathological analysis
Tissues from rhesus and cynomolgus monkeys, including skin lesions, non-lesioned skin, heart, liver, spleen, lung, kidney, brain, intestine, and lymph nodes, were collected at necropsy following the study period. Samples were fixed in 4% paraformaldehyde, processed into slides, and stained with hematoxylin and eosin (H&E). For skin sampling, lesions and adjacent non-lesioned skin were preferentially collected from the limbs. In animals with more than five lesions, five lesion sites and five corresponding non-lesioned areas were sampled; in those with fewer than five lesions, all lesions and five non-lesioned areas were analyzed. Slides were imaged using a 3D Histech Pannoramic MIDI microscope (Hungary) and examined with CaseViewer 2.4 software. Pathological evaluations were performed by a pathologist with over 10 years of histology experience and independently verified by a second pathologist.
Statistical analyses
Graphical representation and statistical analyses were performed using Prism 10.0 software (GraphPad software). All the data were presented as the means ± SEM. Differences between two independent samples were evaluated by two-tailed Student’s t-tests. Differences between multiple samples were analyzed by one-way or two-way analysis of variance (ANOVA). Exact P values are provided in figures. All experiments were conducted with at least 3 independent biological replicates.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.