Antibodies and reagents
The anti-GAPDH (AC054) antibody and anti-β-Actin (AC028) antibody were obtained from ABclonal Technology. The anti-Caspase-1 P20 (AG-20B-0042) antibody and anti-NLRP3 (AG-20B-0006) antibody were purchased from Adipogen Life Science. The anti-NP (H1N1) (GTX125989) antibody was obtained from Genetex. Antibodies for FLAG (M185-7), MYC (M192-7), HA (M180-7) were all purchased from MBL. The anti-IL-1β (M185-7) antibody was obtained from Proteintech. The anti-Ubiquitin (sc-8017) antibody was purchased from Santa Cruz Biotechnology. LTB4 (20110) and KH7 (13243) were obtained from Cayman Chemical. Ethanol (E130059) was purchased from Aladdin. H89 (HY-15979) was obtained from MCE.
Viruses
All in vitro and in vivo infection were performed using Influenza A/Puerto Rico/8/34 (PR8), kindly provided by Prof. Jing-Ren Zhang (Tsinghua University, China). The PR8 virus was propagated in d in 9-day-old specific pathogen-free (SPF) chicken embryos and titrated on MDCK cells using standard plaque assays.
Mice and animal models
The C57BL/6JGpt-Ltb4r1em1Cd2118/Gpt (Lrb4r1−/− mice; Strain NO. T006466) and C57BL/6JGpt-Nlrp3em7Cd4411/Gpt (NLRP3−/− mice; Strain NO. T010873) were purchased from Gempharmatech (Jiangsu, China). The Caspase-1−/− and AIM2−/− mice were kindly provided by Prof. Feng Shao (National Institute of Biological Sciences, China). Mice were housed at 18–23 °C with 40–60% humidity under a normal 12 h light–dark cycle with food and water available ad libitum, in the specific-pathogen-free facility at Institute of Biophysics of Chinese Academy of Sciences (Beijing, China). All animal experiments were carried out in accordance with the Statute on the Administration of Laboratory Animals by the Ministry of Science and Technology of China, using protocols approved by the institutional Animal Care and Use Committee at the Institute of Biophysics of Chinese Academy of Sciences (approval number SYXK2023190 and ABSL-2-2023026). Experimental animals were randomly allocated to treatment groups using a computer-generated randomization sequence (random number table method) to ensure unbiased group assignment. All experimental animals were included in accordance with pre-defined protocols, and no subjects were excluded during the study.
For in vivo infection, 6–8-week-old male C57/B6 mice were challenged intranasally (in 30 μL DPBS) with IAV at a LD50 dose of 5000 pfu or a LD100 dose of 15,000 pfu, respectively.
Cell culture, differentiation and Infection
Mouse bone marrow-derived macrophages (BMDMs) were generated according to the previously described method [43]. iBMDM-ASC-GFP cells (immortalized bone marrow-derived macrophages) were kindly provided by Prof. Di Wang (Zhejiang University, China). Human embryonic kidney (HEK) 293T cells (Procell, China) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA). MDCK cells (Procell, China) and L929 cells (Procell, China) were cultured in minimum essential medium Eagle (MEM; Gibco, USA). Cells were routinely cultured at 37 °C with 5% CO2, and all media were supplemented with 10% fetal bovine serum (FBS; Gibco, USA). All cell lines used in this study were routinely tested for Mycoplasma contamination and only Mycoplasma-free cells were used in the experiments.
For in vitro infection, cells were seeded in tissue culture plates the day before infection and randomly allocated to experimental groups using a computer-generated randomization table. Subsequently, cells were inoculated with IAV at a 20 multiplicity of infection (MOI) in fresh and serum-free DMEM for virus infection. After adsorption for 1.5 h at 37 °C, the cells were washed with Dulbecco’s phosphate-buffered saline (D-PBS; Gibco, USA) and cultured in DMEM containing 10% FBS.
Plasmid construction and transfection
Plasmids encoding Ubiquitin including Ub-K6, Ub-K11, Ub-K27, Ub-K29, Ub-K33, Ub-K48, Ub-K63, NLRP3 including NLRP3-PYD, NLRP3-NATCH, NLRP3-LRR, PPKACA including the kinase-dead PRKACA-K72H mutant were kindly provided by Prof. Di Wang (Zhejiang University, China). Truncated mutant vectors NLRP3 (K797R, K821R, K829R, K876R, K878R, K886R, K928R, K940R, K971R, K992R, K1013R and K1023R) were constructed using the Mut Express II Fast Mutagenesis Kit V2 (C214-01, Vazyme, China) according to the manufacturer’s instructions. Plasmids encoding all plasmid DNAs for transfection were prepared using QIAGEN Plasmid Plus Midi Kit (12945, QIAGEN, Germany). HEK293T cells were transiently transfected with Lipofectamine 3000 (L3000015, Invitrogen, USA) according to the manufacturer’s instructions.
Lung tissue histology and injury scoring
The lung samples were promptly fixed in a 4% formalin solution, subsequently embedded in paraffin, and then sectioned into slices with a thickness of 4 μm for the purpose of histopathologic analysis. These sections were stained using hematoxylin and eosin (H&E) to facilitate examination under light microscopy. The slides were randomized, read in a blinded manner, and subsequently assessed using a semi-quantitative scoring system as previously described [4]. Edema, alveolar and interstitial inflammation, alveolar and interstitial hemorrhage, atelectasis, necrosis, and hyaline membrane formation were each assigned scores on a scale ranging from 0 to 4: absence of injury received a score of 0; presence of injury in 25% of the field received a score of 1; presence of injury in 50% of the field received a score of 2; presence of injury in 75% of the field received a score of 3; and presence of injury throughout the entire field received a score of 4. The results were validated by an experienced and qualified pathologist.
RNA isolation and reverse transcription quantitative PCR (qPCR)
Total RNA from the mouse lungs was extracted using TRIzol Reagent (Invitrogen; USA) and was treated with DNase I (Invitrogen; USA) according to the instructions provided by the manufacturer. Total RNA from BMDMs was extracted by an RNA isolation kit (Vazyme; China). First-strand complementary DNA was synthesized from 200 ng of total RNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific; USA). Generated cDNA was subjected to qPCR in a 20 μL reaction volume using a PowerUp SYBR Green Master Mix (Applied Biosystems; USA). Cq values obtained on a CFX96 PCR System (Bio-Rad) were analyzed using the 2−ΔΔCq formula by normalizing the target gene expression to GAPDH or β-Actin.
The following primers were used:
β-Actin For 5′ AACAGTCCGCCTAGAAGCAC 3′
β-Actin Rev 5′ CGTTGACATCCGTAAAGACC 3′
GAPDH For 5′ AGGTCGGTGTGAACGGATTTG 3′
GAPDH Rev 5′ TGTAGACCATGTAGTTGAGGTCA 3′
NLRP3 For 5′ ATTACCCGCCCGAGAAAGG 3′
NLRP3 Rev 5′ TCGCAGCAAAGATCCACACAG 3′
IL-1β For 5′ TGGACCTTCCAGGATGAGGACA 3′
IL-1β Rev 5′ GTTCATCTCGGAGCCTGTAGTG 3′
IL-18 For 5′ GACTCTTGCGTCAACTTCAAGG 3′
IL-18 Rev 5′ CAGGCTGTCTTTTGTCAACGA 3′
Caspase-1 For 5′ CACAGCTCTGGAGATGGTGA 3′
Caspase-1 Rev 5′ TCTTTCAAGCTTGGGCACTT 3′
BLT1 For 5′ ATGGCTGCAAACACTACATCTCCT 3′
BLT1 Rev 5′ CACTGGCATACATGCTTATTCCAC 3′
BLT2 For 5′ ACAGCCTTGGCTTTCTTCAG 3′
BLT2 Rev 5′ TGCCCCAATTACTTTCAGCTT 3′
Immunoblotting and Immunoprecipitation
For Immunoblotting, cells were lysed in RIPA buffer (89901, Thermo Scientific, USA) with 1× Halt Protease and Phosphatase Inhibitor Cocktail (78440, Thermo Scientific, USA) and incubated on a rocker with ice for 30 min and then centrifuged at 12,000 × g, 4°C for 10 min to obtain cell lysates. Cell lysates were boiled at 70 °C for 10 min in 4× LDS loading buffer and resolved by NuPAGE Bis-Tris Mini Gels (Invitrogen, USA).
For immunoprecipitation, whole-cell lysates were lysed by Pierce™ IP buffer (87787, Thermo Scientific, USA) with Protease and Phosphatase Inhibitor (MCE, USA) and then incubated with Anti-DDDDK-tag mAb-Magnetic Agarose beads (M185-10, MBL, Japan) or appropriate antibodies plus Protein A/G beads (Pierce). The beads were washed three to five times with low-salt lysis buffer, and then the immunoprecipitants were resuspended in 30 μL 2× LDS loading buffer and boiled at 70 °C for 10 min and resolved by NuPAGE Bis-Tris Mini Gels.
Enzyme-linked immunosorbent assay (ELISA)
BALF was collected by cannulating the trachea with a 22-gauge needle and washing the lung with 1 mL of cold, sterile DPBS, and then centrifuged (1500 × g; 10 min) at 4 °C. The cell culture supernatants were harvested and centrifuged at 4 °C, 1500 × g for 10 min. For cell lysate, cells were washed by DPBS twice and lysed by Cell Lysis Buffer II (Invitrogen; USA) and centrifuged. Then supernatants were collected and precipitations were discarded. IL-1β, IL-18, LTB4 and cAMP levels were measured by an IL-1β Mouse Uncoated ELISA Kit (Invitrogen; USA), IL-18 Mouse Uncoated ELISA Kit (Invitrogen; USA), LTB4 ELISA and cAMP ELISA kit (Enzo Life Sciences; USA), respectively. LTB4 and cAMP levels were assessed by ELISA (Enzo Life Sciences; USA). The total protein content was assessed by Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher Scientific; USA).
Transcriptomic analysis
The analysis was conducted in R using the Seurat package (v5.0). Quality control was applied to filter cells based on the following criteria: cells with more than 200 and fewer than 3500 detected genes, and less than 10% mitochondrial gene content were retained. SCTransform and canonical correlation analysis (CCA) were then used. Clustering was carried out by Seurat FindClusters function with a resolution of 0.2. Cell type annotation was subsequently performed using the SingleR package.
For bulk RNA-seq, BMDMs from two mice were treated as previously described and then pooled. Total RNA in BMDMs infected by PR8 with or without LTB4 was extracted via a standardized Trizol method, and then quantified and qualified. mRNA libraries were constructed by TruSeq RNA Library Prep Kit (Illumina, USA) and then sequenced by Illumina NovaSeq 6000 platform. Raw data were filtered using Fastp v2.1.0 and then mapped to mouse genome GRCm39. Gene expression counts were finally obtained by featureCounts v1.5.0-p2. Subsequent analyses were performed in R v4.3.0. EdgeR v4.0.1 was used for identifying differentially expressed genes (DEGs) with |foldchange| > 2. KEGG enrichment analysis and gene set enrichment analysis (GSEA) was performed using clusterProfiler v4.10.0 and visualized by ggplot2 v 4.10.0.
Statistical analysis
Parametric tests (Student’s t-test and ANOVA) were selected after confirming normality with Shapiro-Wilk tests (p > 0.05 for all datasets), with variance homogeneity verified using Levene’s test prior to ANOVA. When assumptions were violated, non-parametric alternatives were applied: Mann-Whitney U test for two-group comparisons and Kruskal-Wallis test with Dunn’s post-hoc analysis for multiple comparisons. For instances where variances differed significantly (F > 2.5 by F-test), Welch’s ANOVA with adjusted degrees of freedom was employed.
All experiments were independently repeated at least two or three times with complete inclusion of experimental animals and data points. Investigators remained blinded to group allocation during both data collection and outcome assessment, while animal grouping and treatment administration were performed by separate personnel.
The survival curves were generated using the Kaplan–Meier method, and statistical analyses were conducted employing the log-rank test. Student’s t-tests were utilized to assess the statistical significance between two groups. For comparisons involving three or more groups, analyses were performed using one-way or two-way ANOVA. The statistical analysis method of each experiment was reported in the figure legends. A two-sided p value of less than 0.05 was considered statistically significant. All the statistics were performed using the software GraphPad Prism v9.5.
