Stock Ticker

The first molecular study of Cystoisospora belli and Cyclospora cayetanensis in HIV/AIDS patients from Northern Iran

Studied population and sample collection

This descriptive-analytical study was conducted on stool samples collected from HIV/AIDS patients in Mazandaran province, Iran, between 2023 and 2024. The study employed a cluster random sampling method, which included HIV/AIDS patients admitted for hospital care, those under-treatment at the therapeutic center, and individuals undergoing flow cytometry testing at Imam Khomeini Hospital, Sari, Iran. Inclusion criteria including: (1) Patients with HIV-positive status, (2) Informed consent form completion, and (3) Submission of at least one stool specimen to the laboratory. Furthermore, exclusion criteria were lack of completed informed consent and samples that were not maintained in proper storage conditions.

Ethical considerations

The study protocol was approved by the Institutional Ethics Committee of Mazandaran University of Medical Sciences (Approval No. IR.MAZUMS.REC.1402.17364). Written informed consent was obtained from all participants before sample collection. The study adhered to the ethical principles outlined in the Declaration of Helsinki (2013 revision). To ensure participant confidentiality and privacy, all collected data were anonymized and securely stored.

Participant recruitment and data collection

After obtaining informed consent, participants were asked to complete a structured questionnaire designed to collect demographic and clinical data. The questionnaire gathered information on sex, age, duration of HIV/AIDS infection, duration of diarrhea, pre-existing medical conditions, history of chronic diarrhea, and CD4 + T cells count.

Stool sampling

The detailed instructions were provided to each participant for the proper collection of stool samples. Participants were instructed to maintain sterility conditions by thoroughly washing and drying the perianal area before sample collection. They were asked to provide stool samples within three hours of collection to ensure sample integrity.

DNA extraction and polymerase chain reaction

DNA extraction from the stool samples was performed using a commercially available kit (Favorgen company, Taiwan). The extraction procedures were conducted under the manufacturer’s protocol. Following extraction, the DNA samples were aliquoted and stored at − 20 °C to preserve their integrity for subsequent molecular analyses.

To amplify C. belli DNA, a specific fragment of the IB3 18 S ribosomal RNA gene was targeted using polymerase chain reaction (PCR)15,16. A 175-base pair (bp) fragment of this gene was amplified using the specific primer pair (Forward primer: CCGAACGTCATCCGAAATAG; and Reverse primer: ACTAGGAGCTGACGATACAC).

The samples were placed in a thermocycler with a programmed temperature profile. This included an initial denaturation step at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 30 s. A final extension step was performed at 72 °C for 5 min.

To amplify C. cayetanensis DNA, the small subunit ribosomal RNA gene was used17 to amplify a fragment of 116 base pairs, and for this purpose (Forward primer: GCAGTCACAGGAGGCATATATCC; and Reverse primer: ATGAGAGACCTCACAGCCAAAC).

The samples underwent an initial denaturation step at 95 °C for 5 min, followed by 40 cycles of amplification: denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 30 s. A final extension step was performed at 72 °C for 5 min.

Agarose gel electrophoresis, with a concentration of 1.5% and containing ethidium bromide (0.2 µg/ml), was utilized to separate the PCR products. The resulting bands (175 bp for C. belli and 116 bp for C. cayetanensis) were visualized using a UV transilluminator (Sup 1 and 2).

Sequencing and phylogenetic analysis

Upon confirmation of the desired band via agarose gel electrophoresis, 20 µL of the PCR product containing the target fragment was selected for further analysis. The PCR product, along with 15 µL of diluted forward and reverse primers, was sent to Gene Fanavaran Company (Iran) for purification and sequencing.

The obtained sequences were analyzed using Bio-Edit software for initial processing and quality assessment. Sequence homology was evaluated using the NCBI-BLAST search system. Multiple sequence alignment was performed using the CLUSTAL W program to compare the obtained sequences with reference sequences.

To investigate the phylogenetic relationships of the nucleotide sequences derived from this study, standard reference sequences and gene bank sequences were incorporated. Phylogenetic analysis was conducted using Mega software version 10. The Neighbor-joining method was employed to construct phylogenetic trees, enabling the identification and classification of parasite genotypes based on genetic similarities and evolutionary relationships.

Statistical analysis

To analyze the data and determine the relationship between the prevalence of parasites and demographic factors, Excel 2019 and IBM SPSS 26.0 software were utilized. A significance level of p < 0.05 was considered statistically significant.

Source link

Get RawNews Daily

Stay informed with our RawNews daily newsletter email

Treasury Secretary Pulled Mid-Interview for Urgent Meeting With President, on Video

EURUSD Technicals: The EURUSD corrects higher but runs into topside resistance

Barcelona v Sevilla: Line-ups, stats and preview

There's a new wedge issue playing out in Senate Dem primaries