Stock Ticker

The developing role of NRF2 and HMOX1 in treatment response of cutaneous leishmaniasis

Ethical statement

Ethical approval was achieved from the Ethical Committee of Kerman University of Medical Sciences as well as Iran National Committee for Ethics in Biomedical Research under the ethical number of IR.KMU.AH.REC.1402.134 on November 2023. Tissues were not sourced from executed prisoners or prisoners of conscience. Written informed consent for tissue isolation and the publication of data or lesion captures was obtained from all patients, while respecting their anonymity. For participants under the age of 18, written consent was obtained from their parents or legal guardians according to ethical standards. All procedures were performed in compliance with declaration of Helsinki for experiments involving humans. Unresponsive patients were referred to the university teaching hospitals for subsequent evaluation and laboratory tests to consider combination therapy. Demographic data were collected in a confidential manner.

Study region

This study was conducted at Afzalipour Hospital in Kerman, in southeastern of Iran as a referral center for the management of patients with CL. All patients referred to the Salk treatment center within this hospital and received Glucantime®(Sanofi-Aventis, Paris, France) treatment at no costs, based on the World Health Organization (WHO) protocol. This protocol was first implemented following the catastrophic earthquake and subsequent CL outbreak in Bam, Kerman province36. This center is staffed by qualified doctors and trained personnel, ensuring comprehensive care for CL patients.

Responsive and unresponsive individuals

Responsive cases were defined as patients who showed absolute re-epithelialization of the lesion without any relapse after six months of follow-up, following a single course of Glucantime®, either alone or in conjunction with cryotherapy. Conversely, unresponsive patients were defined as individuals who continued to exhibit active lesions despite undergoing two treatment courses of Glucantime®. This medication was administered either systemically at a dosage of 20 mg/kg per day for 3 weeks, or intralesionally once a week for 12 weeks, combined with cryotherapy using liquid nitrogen37.

Clinical presentations

Patients were selected at random from those with ACL lesions who were referred to Afzalipour hospital between January 2022 and February 2024. A total of 31 patient were obtained, including 21 individuals from unresponsive to Glucantime® and 10 from those who were responsive. Subsequently, their baseline demographic and clinical characteristics, including number, location, size, and duration of lesions were assembled, separately. Sample isolates were identified at Pathology and Stem Cell Research Center, School of Medicine, Kerman University of Medical Sciences in Kerman.

Sampling procedure

Isolates were obtained by excising tissue from the edge of the lesions using a scalpel with a No. 15 blade for scraping. A smear was prepared from the samples, fixed by methanol, stained with Giemsa, and accurately observed by a light microscope to confirm the presence of Leishman bodies (amastigotes). In parallel, samples were cultured in Novy–MacNeal–Nicolle medium (NNN) at PH = 7.2 and 24 ± l °C for one week in case of parasite isolation for nested polymerase chain reaction (PCR). Moreover, a portion of each sample was set aside for RNA isolation and further assays.

Verification of Leishmania isolates

DNA extraction

DNA extraction was performed on promastigotes isolated from the clinical samples using the QIAamp DNA Mini Kit (Qiagen, Germany). Following the manufacturer’s instructions, 15 µL of proteinase K was added to 1.5 mL microtubes, initially. Next, lesion samples along with 200 µL of BL buffer, were introduced into each microtube. The microtubes were then Vortexed and incubated in a water bath at 56 °C for 30 min. Afterward, samples were centrifuged as kit’s instructions, and the extracted DNA was stored at −18 °C.

Nested PCR assay

The nested PCR procedure involved two consecutive steps, as previously described elsewhere21. In summary, two ordinary primers, CSB2XF (CGAGTAGCAGAAACTCCCGTTCA) and CSB1XR (ATTTTTCGCGATTTTCGCAGAACG), were employed as external primers. For the next round, specific internal primers 13Z (ACTGGGGGTTGGTGTAA AATAG) and LiR (TCGCAGAACGCCCCT) were used. The terminal PCR products were analyzed utilizing 1.5% agarose gel electrophoresis and visualized with a UV transilluminator (Uvitech, Cambridge, UK). It was previously established that L. tropica generates the largest PCR product among Leishmania species, measuring 750 bp. Additionally, it can be easily distinguished from L. major, which has a PCR product of 560 bp21.

Predicting microRNAs

To predict NRF2 and HMOX1 related miRNAs, we utilized TargetScanHuman 8.0 (TargetScanHuman 8.0) and miRTarBase (miRTarBase) algorithms. TargetScan identifies miRNA targets by finding conserved 8 mer, 7 mer, and 6 mer sites matching the seed region38. Subsequently, predicted miRNAs were checked with miRTarBase database as mentioned elsewhere39. According to the algorithm’s reports, two specific miRNAs were selected: mir-24a-3p, associated with NRF2, and mir-27b-3p, linked to HMOX1.

RNA extraction and cDNA synthesis

Total RNA was extracted from the initial isolates of 31 unresponsive and responsive patients using the High Pure RNA isolation kit (Roche-Mannheim, Germany) according to the producer’s instructions. DNase1 (Roche-Mannheim, Germany) was utilized to remove any contaminating DNA. Afterward, the quality and quantity of the RNA samples were assessed employing a Nanodrop (ND-2000, Thermo Scientific Fisher, USA). Complementary DNA (cDNA) synthesis was carried out employing the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) based on the provided guideline. This mixture was first incubated at 37 °C for 15 min, followed by a 5 s incubation at 85 °C to inactivate the reverse transcriptase. Eventually, the cDNA was diluted in distilled water that is free of DNase and RNase.

Synthesis of cDNA based on stem-loop miRNA method

After extracting RNA from the samples, the real-time stem-loop primer developed by Bonyakhteh was applied, which is part of the BONmiR High Sensitivity MicroRNA 1 st Strand cDNA Synthesis Kit (BN-0011.17.2, Bonyakhteh, Tehran, Iran). Universal cDNA synthesis was performed using a thermocycler with the following conditions: 10 min at 25 °C, 60 min at 42 °C, and 10 min at 70 °C. The synthesized cDNA was then kept at − 20 °C for future real-time PCR (RT-PCR).

RT-PCR assay

MiRNA expression

The study employed RT-PCR to analyze miRNAs expression, using U6 as internal control (Table 1). The RT-PCR reactions were performed using a Rotor-Gene 6000 real-time PCR cycler (Corbett, Qiagen) with the BON qPCR Master mix protocol (Bonyakhteh, Tehran, Iran, BN-0011.17.4.1). The PCR reactions were then conducted under the following conditions: initial denaturation (95 °C for 2 min), and amplification cycles, including 45 cycles of 95 °C for 5 s and 62 °C for 20 s. This experiment was done in triple conditions.

Gene expression

RT-PCR was executed to verify the differences in expression level four apoptosis-related and two treatment-unresposiveness indicators within the responsive and unresponsive isolates. The primers were detected by Primer Bank (PrimerBank). Subsequently, their efficiency was evaluated using sequential dilutions of pooled cDNA in RT-PCR, with the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primer acting as the housekeeping gene for normalization. The sequences of the genes amplified in this study are provided in Table 1. This assay was conducted using SYBR Premix Ex Taq II (Takara, Japan) on a Rotor-Gene 6000 real-time PCR cycler. The RT-PCR amplification was executed in triplicate, starting with an initial denaturation step at 95 °C for 20 s, followed by 40 cycles of 94 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s. To confirm reaction specificity, melt curve analysis was conducted.

Immunohistochemistry

The skin samples were accurately placed in 10% buffered formalin for routine tissue processing and were ultimately embedded in paraffin blocks for tissue sectioning and Hematoxylin and Eosin staining. The IHC assay was then performed employing Bax (Zytomed, ID code: 502_17990, Germany) and Bcl2 (monoclonal antibody, mouse, ID code: PDMO16- lot_H147, USA) markers based on the manufacturer’s protocols. The expression levels of apoptotic proteins were assessed by determining the stained cells and calculating the average across ten microscopic fields (400×). Quantitative analysis of Bax and Bcl2 protein expression was done by ImageJ software (National Institutes of Health and the Laboratory for Optical and Computational Instrumentation) within the IHC profiler program40. The results were displayed as a percentage value.

Statistical analysis

Data were analyzed using SPSS v.20 and GraphPad Prism v.10. One-way ANOVA test was applied to determine the differences between the responsive and unresponsive groups. The following equation was used to calculate comparative threshold (CT): [ΔCT = CT (target) – CT (reference)]. Moreover, the relative expression was considered using the ΔCT approach and 2−ΔCT method was employed as a relative quantification strategy for RT-PCR data analysis. Ultimately, a P-value of less than 0.05 was chosen statistically significant. Data were reported as mean ± standard deviation (SD).

Source link

Get RawNews Daily

Stay informed with our RawNews daily newsletter email

Dua Lipa vs. Hennessy Who’d You Rather?! Hello Kitty’s Edition

Japan’s Nikkei seen surging to 60,750, extending historic record-breaking run

Spirit Airlines reaches deal to exit bankruptcy by early summer

U.S. Hockey Gold Medal Win Breaks TV Record, Averages Over 20 Million Viewers