Human subject information

EEEV-373 was isolated from one research subject as previously described in ref. ⁴². Briefly, peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood samples by density gradient purification and cryopreserved until use. Written informed consent was given from the subject and protocols were approved by the Institutional Review Board (IRB) at Vanderbilt University Medical Center for the recruitment and collection of blood samples used in this study (8675).

Mouse model

Animal models were performed as previously described in refs. ^40,42. C57BL/6 mice were purchased from Jackson Laboratories. All animal procedures were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Utah State University IACUC protocol #10025.

Cell lines

Cell lines were maintained as previously described in refs. ^39,40,42. Routine mycoplasma detection was performed using a universal mycoplasma detection kit (ATCC) and in all cases gave negative results for the cell lines tested except for the kit positive control reagent.

Viruses and virus-like particles (VLPs)

The chimeric virus Sindbis virus (SINV; TR339)/Eastern equine encephalitis virus (EEEV; strain FL93–939) was previously described in ref. ⁴³. Briefly, the structural proteins genes of SINV TR339 were replaced with the structural protein genes of EEEV (FL93-939) under control of the SINV 26S subgenomic promoter in the cDNA clone. For wild-type virus neutralization studies, EEEV (strain FL93-939) was derived from a cDNA clone as previously described in refs. ^39,51. For animal studies, the EEEV FL93-939 strain used was obtained from Dr. Robert Tesh, World Reference Center for Emerging Viruses and Arboviruses (University of Texas Medical Branch), Galveston, TX and passaged twice in Vero cells prior to use in mice^40,42. Purified EEEV VLPs were kindly provided by Dr. John Mascola⁵².

Recombinant proteins

Recombinant EEEV E2/E1 and monomeric E1 proteins (strain FL93-939) were expressed and purified as previously described, respectively^39,40. Briefly, the proteins were codon-optimized, synthesized, and cloned into the mammalian expression vector pcDNA3.1(+). Recombinant proteins were produced in Expi293F cells using the ExpiFectamine 293 transfection kit according to manufacturer’s instructions (Thermo Fisher Scientific). Cell supernatant was clarified and purified through a HisTrap excel column (Cytiva) on an ÄKTA pure 25 M chromatography system. Recombinant EEEV E3E2/E2 (strain v105), which contains a mixture of E3E2 and E2 glycoproteins, was purchased from IBT Bioservices.

SINV/EEEV production and purification

For binding and neutralization assays, SINV/EEEV was produced using the methods previously described in refs. ^39,42. For cryo-EM studies, SINV/EEEV was purified according to the previously described protocol^6,40. For liposomal fusion inhibition studies, SINV/EEEV was purified and labeled with Vybrant DiD cell-labeling solution as previously described in ref. ⁴⁰.

Human hybridoma antibody generation and sequence analysis

EEEV-373 hybridoma cell lines secreting EEEV-373 IgG was generated, selected, and purified as previously described in refs. ^39,40,42. Recombinant mAbs were produced using the ExpiCHO expression system (Thermo Fisher Scientific) as previously described in ref. ⁴². Antibodies were purified from clarified supernatants using HiTrap MabSelect SuRe (Cytiva) columns on an ÄKTA Pure 25 M chromatography system and further concentrated using 50 K MWCO Amicon® Ultra centrifugal filter units (MilliporeSigma), desalted, and buffer exchanged with 7 K MWCO Zeba desalting columns (Thermo Fisher Scientific). For the generation of EEEV-373 Fab or F(ab′2) molecules, hybridoma mAb was cleaved using the IgdE cysteine enzyme FabALACTICA® (Genovis) as previously described in ref. ⁴² or using the IdeS protease (Promega), respectively. Briefly, IgG was incubated with FabALACTICA® or IdeS protease (1 unit/1 µg of IgG) overnight at room temperature or 37 °C for 30 to 60 min, respectively. Fab or F(ab′2) molecules were then purified using the CaptureSelect^TM IgG-Fc affinity matrix (Thermo Fisher Scientific). For sequence analysis of EEEV-373 (Supplementary Tables 2, 3), the gene segments and V-region nucleotide percent identity compared to germline were determined using the ImMunoGenetics (IMGT) database as previously described in refs. ^39,42.

Protein EC₅₀ ELISA

To determine the binding EC₅₀ values of EEEV-373 to recombinant antigens an ELISA was performed as previously described in refs. ^39,42. Briefly, EEEV VLPs (2 µg/mL) and recombinant EEEV E3E2/E2 (2 µg/mL), E2/E1 (3.84 µg/mL), or E1 (2 µg/mL) proteins were diluted in 1× D-PBS to coat 384-well ELISA plates (Thermo Fisher Scientific) and incubated at 4 °C overnight. The plates were aspirated and incubated with blocking solution (2% non-fat dry milk (Bio-Rad), 2% goat serum (Thermo Fisher Scientific) in 1× D-PBS-T [1× D-PBS + 0.05% Tween 20]) for 1 h at room temperature. EEEV-373 IgG, F(ab′)2, or Fab molecules were initially diluted to 33 nM then serially diluted 3-fold in blocking solution (1% non-fat dry milk, 1% goat serum in 1× D-PBS-T). Abs then were added to the plates and incubated at room temperature for 2 h. The plates then were washed 3× with 1× D-PBS-T and incubated with a solution of secondary antibodies (goat anti-human kappa-HRP and goat-anti-human lambda-HRP [Southern Biotech]) diluted 1:4,000 in blocking solution (1% non-fat dry milk, 1% goat serum in 1× D-PBS-T) for 1 h at room temperature. The plates then were washed 3× with 1× D-PBS-T followed by the addition of One-Step^TM Ultra-TMB ELISA substrate solution (Thermo Fisher Scientific) for ~5 min. The reaction was stopped with 1 N HCl and optical density then was read at 450 nm with a BioTek^TM plate reader.

Binding kinetics analysis using a quartz crystal microbalance biosensor

EEEV VLPs (35 µg/mL) diluted in 10 mM HEPES buffer (pH 7.4) were immobilized onto LNB carboxyl sensor chips (Attana AB) by amine coupling using EDC (1-ethyl–3-[3-dimethylaminopropyl]-carbodiimide hydrochloride) and Sulfo-NHS (N-hydroxysulfosuccinimide) chemistry on the Attana Cell^TM 200 instrument (Attana AB). For binding assays, first to account for background binding, the sensor chips were injected with running buffer (1× HBS-T). EEEV-373 IgG (33, 8, or 0.33 nM), F(abʹ)2 (35, 10, or 0.35 nM), or Fab (35, 10, or 0.35 nM) molecules diluted in running buffer then were injected to observe Ab binding to EEEV VLPs. Between Ab injections, EEEV VLP immobilized LNB carboxyl sensor chips were regenerated using 10 mM glycine pH 3.5 buffer. Assays were performed at a flow rate of 10 µL/min at 22 °C using 50- and 600 s association and dissociation times, respectively. Data were collected on the Attester software (Attana AB). A blank LNB carboxyl sensor chip was used as a reference and subtracted using the Evaluation software (Attana AB). Curves were fitted and kinetic parameters calculated using a bivalent (IgG and F(ab′)2) binding model using the TraceDrawer software (Ridgeview Instruments AB).

Binding kinetics analysis using biolayer interferometry

Biolayer interferometry was performed using an Octet® HTX system (Sartorius). Following a baseline measurement in kinetics buffer (Sartorius), 10 µg/mL of EEEV-373 IgG, F(ab′)2, and negative control IgG molecules, or 6.7 µg/mL of EEEV-373 and EEEV-94 Fab molecules were separately loaded to protein L biosensors (Sartorius). The biosensors were then dipped into kinetics buffer followed by incubation with EEEV VLPs at concentrations of 0, 0.2, 0.5, 0.8, 1, or 2 nM for 300 s. Dissociation was then measured by biosensor incubation in kinetics buffer for 1800 s. A reference subtraction was performed for each antibody and curves were fitted using a 1:1 binding model. Kinetic analysis was performed using the Octet® Data Analysis v12.2 software (Sartorius).

Cell surface display EEEV binding

Binding analysis of mAbs to cells expressing alphavirus structural proteins has been previously described in refs. ^39,42,53. Briefly, Expi293F cells were transiently transfected with a plasmid (pcDNA3.1(+)) containing the structural proteins (capsid-E3-E2-6K-E1) of EEEV (strain FL93-939) using the ExpiFectamine 293 transfection kit according to manufacturer’s protocols (Thermo Fisher Scientific). Cells were incubated at 37 °C in a humidified atmosphere of 8% CO₂ for 24 h. Cells then were harvested, fixed with 1% PFA/PBS, washed twice with 1× D-PBS, and stored at 4 °C in FACS buffer (1× D-PBS, 2% ultra-low IgG FBS, 2 mM EDTA) until use. Cells were plated at 40–50,000 cells/well in 96-well V-bottom plates. EEEV-373, rEEEV-106, or rDENV-2D22 IgG were diluted to 1 µg/mL in FACS buffer and incubated with the cells at 4 °C for 1 h. Cells then were washed with FACS buffer and incubated with secondary antibodies (anti-human IgG-PE and anti-human IgA-PE [Southern Biotech]) diluted 1:1,000 in FACS buffer for 1 h at 4 °C. Cells then were washed in FACS buffer, and the number of events was collected on an IntelliCyt® iQue Screener Plus flow cytometer (Sartorius).

Dynamic light scattering (DLS)

DLS was performed to assess antibody-mediated aggregation of virus particles as previously described in ref. ⁴⁰. Briefly, EEEV-373 IgG, F(ab′)2, or Fab molecules were mixed and incubated at 37 °C for 30 min with EEEV VLPs at Ab:VLP molar ratios ranging from 1:1 to 1,000:1. VLPs were incubated without mAb to control for particle size (~70 nm). DLS was then performed at 37 °C using a biologics stability screening platform (Uncle) and Uncle version 5.0 analysis software (Unchained Labs). Mean peak intensity was used to determine the hydrodynamic diameter (nm) of EEEV VLPs.

ApoER2 and VLDLR receptor blockade

EEEV VLPs were diluted to 2 µg/mL in 1× D-PBS to coat 384-well ELISA plates (Thermo Fisher Scientific) and incubated at 4 °C overnight. The plates were aspirated and incubated with blocking solution (2% non-fat dry milk (Bio-Rad), 2% goat serum (Thermo Fisher Scientific) in 1× D-PBS-T [1× D-PBS + 0.05% Tween 20]) for 1 h at room temperature. EEEV-373 or a negative control mAb were diluted for a final concentration of 3 to 67 nM in blocking solution (1% non-fat dry milk, 1% goat serum in 1× D-PBS-T). MAbs then were added to the plates and incubated at room temperature for 1 h. Recombinant human apolipoprotein E R2 protein (ApoER2; R&D Systems) or human very low-density lipoprotein receptor (VLDLR; R&D Systems) protein were diluted to a final concentration of 5 µg/mL. ApoER2 or VLDLR were then added to the plates and incubated at room temperature for 1 h. The plates then were washed 3× with 1× D-PBS-T and incubated with a solution of secondary antibodies (anti-his-HRP [Thermo Fisher Scientific]) diluted 1:2,000 in blocking solution (1% non-fat dry milk, 1% goat serum in 1× D-PBS-T) for 1 h at room temperature. The plates then were washed 3× with 1× D-PBS-T followed by the addition of One-Step^TM Ultra-TMB ELISA substrate solution (Thermo Fisher Scientific) for ~5 min. The reaction was stopped with 1 N HCl and optical density then was read at 450 nm with a BioTek^TM plate reader. Percent binding of ApoER2 or VLDLR was normalized to the average optical density value for binding in the presence of the negative control mAb.

SINV/EEEV neutralization assays

Neutralization assays, including the focus reduction neutralization test (FRNT) and post-attachment assays, were formed as previously described in refs. ^39,40,42. Briefly, EEEV-373 IgG, F(ab′)2, or Fab molecules were initially diluted to 33 nM then serially diluted 3-fold in medium (DMEM/2% ultra-low IgG FBS/10 mM HEPES). Abs were then incubated with ~100 FFU/well of SINV/EEEV and incubated together for 1 h at 37 °C in a humidified atmosphere of 5% CO₂ or 4 °C, respectively. Virus foci were detected as previously described.

Liposomal fusion inhibition assay

Liposomes (2 mM) containing 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), sphingomyelin (chicken egg), and cholesterol (ovine wool) were prepared as previously described in ref. ⁴⁰. Fusion inhibition was assessed as previously described in ref. ⁴⁰. Briefly, Vybrant DiD-labeled SINV/EEEV particles were incubated with EEEV-373 or negative control IgG (9 µg), F(ab′)2 (6.2 µg), or Fab (3 µg) molecules for 30 min at room temperature with shaking (300 rpm). Buffer with no Ab or liposome controls were also included. Prepared liposomes (2 mM) then were added, expect for the no liposome control, and loaded onto a SpectraMax iD5 multimode plate reader (Molecular Devices) at 37 °C. Sequential injections of 0.1 M MES-0.2 M acetic acid (pH 5.0) were performed using an automated injector and mixed immediately. Fluorescence (excitation at 635 nm, emission at 675 nm) then was read every 10 s for a total of 100 s.

Egress inhibition assay

Egress inhibition was performed as previously described in ref. ⁴⁰. Briefly, BHK-21 cells were inoculated with SINV/EEEV (MOI 1) in medium (DMEM/2% ultra-low IgG FBS/10 mM HEPES) and then incubated at 37 °C in a humidified atmosphere of 5% CO₂ for 2 h. Cells then were washed 6× with medium containing 25 mM NH₄Cl. EEEV-373 or rDENV-2D22 IgG were diluted to 10 µg/mL in the same medium and added to the cells. The previously published negative control mAb, rDENV-2D22 IgG, and SINV/EEEV only control groups performed at the same time were included for comparison⁴⁰. The cells then were incubated at 37 °C in a humidified atmosphere of 5% CO₂ for up to 6 h. Supernatant was harvested after 1- and 6-hour incubation periods. Viral RNA then was extracted from the supernatant using the Maxwell® Viral Total Nucleic Acid purification kit on the Maxwell® system (Promega). qRT-PCR and quantification of relative RNA copies/µL were performed as previously described using the SuperScript^TM III Platinum One-Step qRT-PCR kit (Thermo Fisher Scientific)⁴⁰.

SINV/EEEV escape mutant generation and analysis

To assess the ability for viral escape in the presence of EEEV-373, a real-time cell analysis (RTCA) assay and xCELLigence RTCA Multiple Plates instrument was used. The RTCA assay was performed by adding DMEM/2% ultra-low IgG FBS/10 mM HEPES to each well of a 96-well E-plate to establish a background reading. Vero cells (~18,000) were then seeded to each well of the E-plate overnight. Continuous monitoring of cell index values was performed every 15 min and analyzed using the RTCA software. Initial establishment of the neutralization potency of EEEV-373 in the RTCA assay was performed by incubating SINV/EEEV at an MOI of ~0.06 with serial three-fold dilutions of EEEV-373 or a negative control mAb starting at 10 µg/mL for 1 h at 37 °C in 5% CO₂. The virus:mAb complexes were then added to the Vero cell monolayers and continuously monitored for changes in cell index values over time. Wells containing only medium or SINV/EEEV were included as controls. Normalized cell index values approximately 48 h post-inoculation were determined to establish the percent neutralization. To select for escape mutant viruses, a similar experiment was performed with some modifications. SINV/EEEV at an MOI of ~0.06 was incubated with saturating concentrations (50 and 10 µg/mL) of EEEV-373 or a negative control mAb for 1 h at 37 °C in 5% CO₂. The virus:mAb complexes were then added to the Vero cell monolayers and continuously monitored for changes in cell index values over time. Wells in which cytopathic effect was observed in the presence of EEEV-373 compared to control wells were identified as potential escape mutants and supernatant was collected.

To verify the observed phenotype, supernatants were incubated in the absence or presence of EEEV-373 (20 µg/mL), added to confluent Vero cell monolayers in a 6-well plate, and then incubated at 37 °C in 5% CO₂. Supernatants were then collected, and viral RNA was extracted using a QIAmp viral RNA extraction kit (Qiagen). cDNA corresponding to the E2 protein gene was then generated and amplified using a SuperScript^TM III One-Step RT-PCR system with Platinum^TM Taq DNA polymerase (Thermo Fisher Scientific) with the following forward and reverse primers, respectively: 5′ ATGTGCGTCCTGGCCAATATCACGTTTCC 3′ and 5′ GAACAAAACTAGGGCAACCACTGCTGTAGC 3′. The PCR product was then purified using a QIAquick PCR purification kit (Qiagen). The resulting product was sequenced using long-read Oxford Nanopore technology (Plasmidsaurus). From the obtained sequences, variants were identified and compared to consensus sequences or the corresponding input wild-type SINV/EEEV sequence. Escape mutant viruses were identified as variants obtained only in the presence of EEEV-373.

EEEV plaque reduction neutralization test

The neutralization activity of EEEV-373 against wild-type EEEV (strain FL93-939) was performed as previously described in ref. ³⁹. Briefly, EEEV-373 (75 nM) was serially diluted 2-fold and incubated with ~100 PFU of EEEV at 37 °C for 1 h. The previously published anti-EEEV ascites fluid (ATCC) and rDENV-2D22 IgG positive and negative controls, respectively, performed at the same time were included for comparison³⁹. Ab:virus complexes then were added to Vero cell monolayer cultures and incubated at 37 °C for 1 h. An agarose overlay then was added and plates were incubated at 37 °C for 2 days. For detection of plaques, a neutral red overlay was added.

Mouse subcutaneous EEEV challenge model

Mice were challenged with EEEV by bilateral subcutaneous injections as previously described in refs. ^40,42. Mice were treated with EEEV-373 at 10 mg/kg via a single intraperitoneal injection 24 h after EEEV challenge. Previously published controls, including rDENV-2D22 IgG and normal controls, performed at the same time were included for comparison^40,42. The mice were monitored for 21 days post-virus inoculation (dpi) for survival, disease signs, and body weight. Serum was collected from the mice 3 dpi to assess virus titers via an infectious cell culture assay as previously described in refs. ^40,42.

Sample preparation for cryo-EM and data collection

SINV/EEEV particles were mixed with EEEV-373 at a ratio of 1:1 (virus:IgG) and 3 µL of the virus-IgG mixture was immediately loaded onto glow discharged lacey carbon grids in a BSL2-containment facility. The grids then were blotted for 3.2 s and plunge frozen in liquid ethane using a Gatan CP3. The entire process was performed under 30 s to avoid potential aggregation of the particles. The frozen grids of the complexes were imaged using a Gatan Bioquantum-K3 camera mounted on a Titan Krios (Thermo Fisher Scientific) microscope. The data collection parameters are listed in Supplementary Table 1.

Cryo-EM data processing

Data was processed as previously described in ref. ⁴⁰. The resolution of the final map (4.6 Å) was calculated using the Gold Standard Fourier Shell Correlation (GSFSC) coefficient at 0.143⁵⁴. Although the quality of the map was sufficient to resolve the glycoproteins, the density of the bound IgG molecule was quite poor. To improve the density of the bound IgG, localized reconstruction of the i2 was performed. For this, sub-particles at the i2 were extracted and 3D classified into 10 classes without imposing any symmetry (C1) in Scipion⁵⁵. The best classes with well-defined structural features were pooled (289,759 sub-particles) and further refined in Relion⁵⁶ with C1 symmetry until the refinement converged. At this step, the estimated resolution according to GSFSC coefficient at 0.143 was 4.3 Å. Although the quality of the map for the bound IgG improved in comparison to the icosahedral map, it was still not useful for atomic model fitting. Therefore, a mask was applied to the two IgG bound q3 spikes and another round of 3D classification within the masked volume into three classes were carried out in Relion. One class contained with well-defined features and this class (271,460 sub-particles) was further refined using C1 symmetry in Relion. This generated a map of the bound IgG of sufficient quality to begin atomic model fitting. No density was observed for either the hinge or Fc region of the antibody. The resolution of this final map was estimated to be 3.8 Å according to the GSFSC coefficient at 0.143. Although the resolution estimation of the map is global, visual inspection revealed a resolution range across the map. Therefore, local resolution estimation of the map was carried out in Relion, which estimated the resolution of the epitope-paratope interaction surface to be around 5 Å. The map was sharpened using Autosharpen in Phenix⁵⁷. The statistics of the data collection and structure reconstruction are listed in Supplementary Table 1. A schematic of the data processing is described in Supplementary Fig. 7.

Model building and fitting into the cryo-EM density map

The ectodomain models of EEEV E2 and E1 were obtained from the Protein Data Bank (PDB ID: 6MX4). A homology model of EEEV-373 was built using AlphaFold 3. Rigid body fitting of the ectodomains and the Fab arms of the IgG into the 3.8 Å map corresponding to the two q3 spikes cross-linked by EEEV-373 were carried out in ChimeraX⁵⁸. The fitted models then were further refined against the map using the Real Space Refinement routine in Phenix⁵⁷. For the E2 and E1 ectodomains simulated annealing was included in the refinement protocol and the variable domains of the IgG were refined without simulated annealing. The resolution of the map corresponding to the constant domains were significantly worse than the rest of the map. Therefore, the constant domains were fitted as rigid bodies. The quality of the model geometry and the clash score were iteratively improved by a combination of Isolde⁵⁹, Coot⁶⁰ and real_space_refinement routine in Phenix. The viral surface area buried by EEEV-373 was calculated using ChimeraX. For fitting into the icosahedral map, the refined model of one of the q3 spikes in complex with the Fab arm of the IgG and a model of the ectodomain of the i3 E2/E1 heterodimer (PDB ID: 6MX4) were fitted in UCSF ChimeraX following T = 4 quasi-symmetry of the asymmetric unit as rigid bodies. Then, the asymmetric unit around the fitted model was extracted using the phenix.map_box command. Only the i3 arm of the model was subjected to the Real_Space_Refine routine in Phenix using default settings against the extracted map corresponding to the asymmetric unit. The model quality was improved as described above. Finally, the refined model is again fitted as a rigid body in the icosahedral map in ChimeraX following T = 4 quasi-symmetry.

Statistical analysis

All statistical analyses were performed using GraphPad Prism version 10 (GraphPad Software). Details about statistical analyses can be found in the figure legends. EC₅₀ and IC₅₀ values were calculated after log transformation of the concentration values and non-linear regression analysis using sigmoidal dose-response (variable slope). Survival curves were compared using the log-rank test with Bonferroni multiple comparison correction (ρ_adj = 1-(1-ρ_orig)ⁿ; n = number of comparisons).

Inclusion and ethics

The research complied with all relevant ethical regulations as established by the institutional review boards associated with all authors.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.