Stock Ticker

Intranasal spike and nucleoprotein fusion protein-based vaccine provides cross-protection and reduced transmission against SARS-CoV-2 variants

Ethics statement

All experiments were performed in accordance with European Guidelines for animal experimentation. The protocols were approved by the local ethics committee (CEEA Centre Val de Loire) and the French Ministry for Research. For immunogenicity experiments, animals were maintained under pathogen-free conditions in the animal facility of the University of Tours (PST-A). The infection experiments were performed in BSL-3 core facility (PFIE, INRAe Centre Val de Loire, France).

Virus isolation and preparation

Delta variant (B.1.617) was isolated from nasopharyngeal swabs collected from patients suffering from COVID-19 at the Tours University Hospital. The strain sequence was deposited on GISAID: B.1.617 strain EPI_ISL_16833396. Virus suspension (200 µL) was inoculated onto 12-well cell culture monolayers of Vero-TMPRSS2 cells which were previously maintained in Dulbecco’s minimum essential medium (DMEM; Gibco, Scotland, UK) supplemented with 10% fetal bovine serum (FBS), 1.5 µg/ml puromycin (InvivoGen, San Diego, USA) penicillin (100 U/mL) and streptomycin (100 mg/mL). Cells were incubated for 1 hour at 37 °C to allow virus adsorption, with rocking every 10 min for uniform virus distribution. After incubation, the inoculum was removed, and the cells were washed with 1× phosphate-buffered saline (PBS). The DMEM supplemented with 2% heat-inactivated FBS was added to each well. The cultures were incubated further in 5% CO2 incubator at 37 °C and observed daily for cytopathic effect (CPE) under an inverted microscope (Olympus IX50). Five days later, supernatant was centrifuged at 4815 × g for 5 minutes at 4 °C, and Tissue Culture Infective Dose 50% (TCID50) quantitation was determined. TCID50 values were calculated by the Reed and Muench method.

Protein design, production, and purification

The recombinant protein vaccine was a heteromultimeric spike-nucleoprotein fusion protein (SwFN). This fusion protein was obtained by co-transfection of two DNA plasmids. The first plasmid encodes a heavy chain (SwFN-hc) consisting of Wuhan spike protein ectodomain (GenBank accession number MN908947) with T4 foldon sequence27, the hinge and CH2-CH3 domains of human IgG1 (IGHG1*01), followed by a peptide linker and the nucleoprotein sequence (GenBank accession number LR824570.1). The second plasmid encodes a light chain (Sw-lc) consisting of spike protein ectodomain with T4 foldon sequence and a C-tag (ThermoFisher Scientific). Thereby, the SwFN protein was composed of six Wuhan spike proteins, an Fc portion, and two nucleoproteins.

The spike sequences were modified to remove the polybasic cleavage site (mutation RRAR:A or R682del, R683del, and R685del), which is recognized by furin28. Furthermore, according to the HexaP variant described by Hsieh et al.29, six other prolines were substituted to stabilize the prefusion conformation (mutations K986P, V987P) and to increase protein expression (mutations F817P, A892P, A899P, A942P).

To evaluate the added value of SARS-CoV-2 nucleoprotein, a control Wuhan spike protein in heteromultimeric form (SwF) was developed according to the same backbone sequence of the SwFN vaccine protein but without nucleoprotein sequence (SwF-hc and Sw-lc chains) and the induced immune response were compared to spike-nucleoprotein fusion protein.

For in vitro cell re-stimulation, spike from Wuhan (Sw), Delta (Sd) (B.1.617.2, GenBank N° MZ208926), and Omicron (So) (B.1.1.529, GenBank N° OW996240.1) strains were produced. The ectodomain sequence of each strain was fused to a T4 foldon sequence followed by the C-tag.

Spike-T4 foldon, nucleoprotein and Fc sequences with optimized codons for Cricetulus griseus were synthesized by GeneArt in pcDNA3.4 plasmid. Specific sequences of interest were amplified by specific PCR primers and were then integrated in pcDNA3.4 plasmid with the BsaI-HF v2 Golden Gate technology (New England Biolabs). Final constructions (pcDNA3.4-Sw-lc, pcDNA3.4-Sd-lc, pcDNA3.4-So-lc, pcDNA3.4-SwF-hc, pcDNA3.4-SwFN-hc) were purified and validated by sequencing analysis. High-quality DNA Plasmids from DH5 bacteria were performed (QIAGEN Plasmid Maxi Kit) and used for ExpiCHO-S cell line transfection according to the manufacturer’s instructions (ThermoFisher Scientific). Briefly, CHO cells were previously diluted at 6 × 106 cells/mL, and ExpiFectamine-DNA plasmid complexes were added. For spike proteins (Sw, Sd, and So), 0.8 µg/mL of DNA plasmid was used. For SwF and SwFN proteins, a ratio of 3:1 (corresponding respectively to 0.6 µg/mL of pcDNA3.4-SwFN-hc and 0.2 µg/mL pcDNA3.4-Sw) was used. Max titer protocol was applied, and supernatants were harvested after 8 days post-transfection when cell viability was greater than 60% (CytoSMART, Corning). Clarified supernatants were obtained after centrifugation at 10,000 × g for 10 min and stored at −20 °C until purification.

Before purification, supernatants were clarified again by centrifugation at 10,000 × g for 20 min followed by 0.22 µm filtration. Protein purification was performed with an Akta purifier (GE Healthcare Europe GmbH) using specific columns for affinity chromatography. HiTrap HP protein A column (Cytiva) was used for heteromultimeric protein purification (SwF and SwFN). The column was equilibrated with PBS (2.7 mM KCl, 0.14 M NaCl, 1.5 mM KH2PO4, 8 mM Na2HPO4, pH 7.4), and bound proteins were eluted after PBS washing with citrate buffer (100 mM, pH 3). Capture Select C-tagXL column (Cytiva) was used to purify spike proteins (Sw, Sd, and So). The column was equilibrated with 20 mM Tris at pH 7.5, unspecific proteins were eliminated with wash buffer (20 mM Tris pH 7.5, 1 M NaCl), and specific C-tag proteins were eluted with citric acid buffer (100 mM, pH 3). Afterwards, a desalting column (HiPrep 26/10 desalting column Cytiva) was used for elution buffer exchange into PBS. Protein concentration was determined with a UV detector at 280 nm. Molecular mass and molar extinction coefficient data were generated by the Protparam tool from http://web.expasy.org/protparam/. Proteins were concentrated with 30 kD Amicon Ultra (Merk Millipor) at 1 mg/mL, sterilized by 0.22 µm filtration and stored at 4 °C.

Prometheus NT.48 was used to measure the thermal unfolding profiles of proteins by differential scanning fluorimetry experiments (Prometheus NT.48, NanoTemper). All samples were used at a final concentration of 1 µM and loaded into high-sensitivity capillaries (Nanotemper). The protein unfolding process was subjected to a thermal ramp (20–95 °C, 1 °C/min). Data analysis involved using Prometheus PR ThermControl software. The Tm value was determined by fitting the tryptophan 350/330 nm fluorescence emission ratio using a polynomial function in which the maximum slope is indicated by the peak of its first derivative.

Antigenicity of produced proteins was studied using anti-N sandwich enzyme-linked immunosorbent assay (ELISA). Flat-bottomed 96-well plates (Nunc) were coated with human anti-SARS-CoV spike Protein S1 Receptor-Binding Domain Antibody (1:1000, 100-0583, Stemcell). Serial two-fold dilutions of SwFN fusion protein, Sw, SwF, and irrelevant protein were performed (starting at 300 µg/mL) and added to the wells. SwFN was detected using anti-SARS-COV-2 Nucleoprotein antibody (1:5000, Stemcell, 100-0580) followed by an IgG (H + L) Cross-Adsorbed F(ab′)2-Goat anti-Rabbit, AP (1:2500, Invitrogen, 15440954). The optical density of each point was read at 405 nm.

Mucosal Nc preparation

The Nc were synthesized according to Dombu et al.30. The maltodextrin (Glucidex from Roquette, France) was dissolved in a 2 N sodium hydroxide solution with magnetic stirring at room temperature, then epichlorohydrin and glycidyl trimethyl ammonium chloride (Sigma-Aldrich, France) were added, leading to the formation of a cationic hydrogel. The gel was then neutralized with acetic acid and crushed by a high-pressure homogenizer (LM20-30 microfluidizer, Microfluidics, France). The Nc were purified over ultrapure water by tangential flow ultra-filtration (Akta Flux6, GE Healthcare, France) using a 300 kDa cutoff hollow fiber and filtered through 0.2 μm.

Vaccine preparation and characterization

Hetero-multimeric spike protein (SwF) and heteromultimeric fusion protein (SwFN) were complexed with Nc at a 3:1 mass ratio (Nanocarriers:Protein) to obtain SwF (Nc-SwF) and SwFN (Nc-SwFN) complexations, respectively. Ncs were mixed with antigen for 1 hour at room temperature under shaking conditions. Water volume was adjusted, and vaccine preparations were stored at 4 °C for 24 h–48 h before use. For immunogenicity and survival experiments in BALB/c and K18-hACE2 mouse models, each mouse was immunized with an equimolar quantity corresponding to 10 µg of spike protein (73.6 pmol). For Nc-SwF complexation, 31.8 µg of Ncs were mixed with 10.6 µg of SwF, and 35.4 µg of Ncs were mixed with 11.8 µg of SwFN to obtain Nc-SwFN complexation. For protection and contagiousness experiments in hamster model, each animal received the equivalent of 50 µg (368 pmol) of spike protein, either a mix of 176.4 µg of nanoparticles and 58.8 µg of SwFN.

Protein complexations (~5 µg of protein) were analyzed using native polyacrylamide gel electrophoresis (PAGE) with silver staining according to the manufacturer’s instructions (Fisher Scientific). SwFN vaccine complexation was analyzed using formvar/carbon-coated nickel grids. TEM imaging was performed with JEOL microscope (1011, Tokyo, Japan) after negative staining with three consecutive contrasting steps using phosphotungstic acid (IBiSA electronic microscopy platform of Tours University). Vaccine local penetration and internalization by the human nasal mucosa were performed in vitro on MucilAir™ cell model of the human airway epithelium (Epithelix) after Nc-SwFN (50 µg/mL) incubation for 30 mins and 6 hours, respectively. Cells were scrapped, fixed, dehydrated, and embedded in Epon resin (Sigma). Ultra-thin sections (90 nm) were obtained with a Leica EM UC7 ultramicrotome (Wetzlar, Germany) and sections were stained with 5% uranyl acetate (Agar Scientific), 5% lead citrate (Sigma). TEM observations were made with JEOL microscope (1011, Tokyo, Japan).

Animal experiments

Animal were housed in an SPF BSL2/3 animal facility under classical light/dark cycle and temperature and where feed ad libitum with fresh water and complete maintenance diet (SAFE A04, Safe-lab, Germany) with bedding and environmental enrichment consisting of shredding paper and plastic igloo available in the cage.

Mice immunizations

BALB/c immunogenicity

Six-week-old female BALB/c mice obtained from CER Janvier (Le Genest Saint Isle, France), were used for immunogenicity experiments. Groups of six mice were immunized twice by intranasal route at 3-week intervals with 20 µL of Ncs alone, SwFN fusion protein, Nc-SwF and Nc-SwFN complexations. Vaccine immunogenicity was evaluated 1 week after the 2nd dose by studying systemic and mucosal immune responses.

K18-hACE2 clinical signs and survival

Eight-week-old female K18-hACE2 mice obtained from Charles River (Saint-Germain-Nuelles, France) were used to study clinical signs and survival after SARS-CoV-2 infection following vaccination. Groups of six mice were immunized with Nc alone, Nc-SwF, and Nc-SwFN complexations. Each group was immunized twice at 3-week intervals by intranasal inoculation. Following immunization and before infection, the serum anti-spike antibody response was analyzed by ELISA. Mice were infected one week after the second immunization with a sublethal dose of 1.3 × 105 TCID50 Delta SARS-CoV-2 variant (20 µL) in order to study the appearance of clinical signs. For the survival study, mice were infected four weeks after the second immunization with a lethal dose of 8 × 105 TCID50 Delta SARS-CoV-2 variant (30 µL). The infectious challenge was performed intranasally, under isoflurane anesthesia. The mice were weighed once a week before infection. Following infection, weight, clinical signs (activity, respiratory distress, lordosis, contracted facies), and survival were assessed daily. Mice were sacrificed by isoflurane overdose followed by cervical dislocation, 10- and 8 days post-infection, respectively, for clinical signs and survival studies. Lung, nasal cavity, olfactory bulb, and brain sections were analyzed by immunohistology.

Hamster immunizations

Four-five-week-old male golden hamsters, chosen for their higher gender susceptibility to the SARS-CoV-2 virus31,32, were obtained from CER Janvier (Le Genest Saint Isle, France). For the protection study, four hamsters received Nc alone, and five hamsters were immunized with Nc-SwFN complexation under isoflurane anesthesia and following a protocol of two intranasal inoculations separated by 3 weeks. Hamsters were challenged via an intranasal route with 5 × 104 TCID50 of SARS-CoV-2 Delta variant (80 µL) under isoflurane anesthesia. Body weights were monitored daily. Viral load in lung and nasal swab were analyzed 2 days post-infection by real-time quantitative reverse transcription PCR (qRT-PCR) and TCID50, respectively. Lung sections were also prepared for analysis by immunohistology.

To evaluate the efficacy of vaccination against SARS-CoV-2 infection and transmissibility by direct contact, 30 hamsters were divided into 10 experimental groups of three animals originating from the same litters to allow serene co-housing. Five hamsters were previously immunized with two intranasal doses (80 µL) of Nc alone or Nc-SwFN complexation at 3 weeks of interval. Hamsters were then challenged 1 week post vaccination via intranasal route with 5 × 104 TCID50 of SARS-CoV-2 Delta variant under isoflurane anesthesia. One day post infection, each Nc or Nc-SwFN vaccinated / infected hamster was transferred back to cohouse for 48 hours, corresponding to previously reported pic of viral shedding, with two naive sentinel hamsters in a new cage allowing both airborne movement, direct contact, and potential fomite transmission to maximize and optimize the contagiousness26. Body weights were monitored daily. At the end of the experiments, hamsters were sacrificed by isoflurane overdose, followed by decapitation. Viral load in lung, olfactive mucosa were analyzed by qRT-PCR and nasal swab by TCID50. Lung sections were also prepared for analysis by immunohistology.

Humoral immune response analysis

Analyses of spike-specific IgG and IgA antibodies were performed by ELISA on serum, nasal and bronchoalveolar washes, collected 1 week after the last immunization. Flat-bottomed 96-well plates (Nunc) were previously coated with 2 µg/mL of spike from Wuhan strain (Sw). To determine respectively endpoint titers and optical density (OD), serial two-fold dilutions (starting at a 1:50 dilution) of serum and pure nasal or BAL washes were performed and added to the wells after plate saturation. Sample of Nc immunized mice served as negative control. For mouse models, goat anti-mouse IgG alkaline phosphatase (1:5000, A3438 Sigma) and goat anti-mouse IgA alkaline phosphatase conjugate (1:1000, A4937 Sigma) were used to detect bound antibodies. For hamster model, IgG and IgA antibodies were detected using goat anti-hamster IgG alkaline phosphatase (1:5000, Sab37700489 Sigma) and rabbit anti-hamster IgA alkaline phosphatase conjugate (1:1,250, Sab 3005 Brookwood Medical). The optical density of each sample was read at 405 nm, and the endpoint antibody titer for each sample was given as the reciprocal of the highest dilution, producing an OD that was 2.5-fold greater than that of the serum of naive mice. Antibody neutralization capacities were evaluated by mCherry SARS-CoV-2 RT-PCR and plaque reduction neutralization tests (PRNT) analysis.

All neutralization experiments were performed in a biosafety level 3 laboratory. The different viral strains that were used were sequenced and deposited on GISAID [GISAID accession numbers: EPI_ISL_1707038, 19 A (B.38); EPI_ISL_1904989, Delta (B.1.617.2); and EPI_ISL_7608613, Omicron (B.1.1.529)]. Neutralization tests were performed as previously described33. Briefly, Decomplemented serum specimens were tested in duplicate at serial 2-fold dilutions from 1/10. Nasal washes and LBA were tested individually in duplicates against Delta and pooled against Wuhan. For the nasal washes and LBA, the percentage of neutralization was estimated only at the dilution of 1/5 and scores of neutralizations were categorized as follow: negative: <20% neutralization; Low : 20-40% neutralization; intermediate : 40–60% neutralization and high : >60% neutralization. The samples were mixed at equal volume with the live SARS-CoV-2 virus. After incubation of the mix for 30 min at room temperature, 150 µL of the mix was transferred into 96-well microplates covered with a monolayer of Vero E6 cells to achieve a viral concentration of 100 TCID50/well. The plates were incubated at 37 °C in a 5% CO2 atmosphere for 5 days. For RT-PCR analysis, SARS-CoV-2 was quantified in the culture supernatant directly without nucleic acid extraction, with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Briefly, 5 μL of supernatant was diluted 1/10 with Dnase-free and Rnase-free water and mixed with the reaction solution to obtain a total volume of 14 μL. The reaction solution contained 5 μL Luna® Universal Probe One-Step Reaction Mix, 0.5 μL Luna® WarmStart® RT Enzyme Mix and 1.5 μL of a mixture of primers at 400 nM (E_Sarbeco_F: ACAGGTACGTTAATAGTTAATAGCGT and E_Sarbeco_R: ATATTGCAGCAGTACGCACACA) and the probe at a concentration of 200 nM (E_Sarbeco_P1: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ). The RT-PCR was initialized with a reverse transcription step at 55 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 60 s. A viral standard curve was obtained for each analysis to calculate the neutralization percentage. For PRNT analysis, the CPE was evaluated after 5 days, and neutralization was recorded if less than 50% of the cells were damaged. The results were presented as very weak, weak and visible neutralizations.

Cellular immune response analysis

Systemic and mucosal cellular immune responses were analyzed one week after the last immunization in order to evaluate the produced cytokines and the functional signature of T cells. Spleen cell suspensions were individually obtained by filtration through nylon mesh. Lungs were harvested using a Lung dissociation kit (Miltenyi Biotec) according to the manufacturer’s instructions. Erythrocytes were removed by lysis (hypotonic shock), and the remaining cells were washed and suspended in RPMI 1640 medium supplemented with 5% FCS, 25 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate, 50 μM β-mercaptoethanol, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cytokine production was analyzed in the supernatant of the spleen and lungs. 5 × 105 cells were stimulated with 10 µg/mL of spike variants (Sw, Sd, and So) or Nucleoprotein (230-30164, Clinisciences). Cytokine productions were analyzed after 72 hours using Mouse MACsPlex cytokine Kit (Miltenyi Biotec) according to the manufacturer’s instructions. Intracellular T-cell cytokine production was also measured. To distinguish circulatory and tissue-resident T cells, BALB/c mice were injected intravenously with 3 μg of anti-CD45-BV510 (clone 30-F11, Biolegend) and were euthanized 3 min later. Cells were incubated for 4 h in a complete medium containing Golgi stop (BD) and anti-CD107-FITC (1:100, BD). Stimulated cells were stained with VioBlue Dye 405-452 (1:100, Miltenyi Biotec), anti-CD8a-Pacific blue (1:2000, clone 53-6.7, Biolegend) and anti-CD4-PE-Cy5.5 (1:160, clone RM4-5, eBioscience) in FACS-PBS for 20 min at 4 °C. After fixation (cytofix, 20 min, 4 °C) and permeabilization (Permwash 1×, 4 °C), cells were stained intracellularly with anti-IL-2-APC (1:300, clone JES6-5H4, Biolegend), anti-TNF-PE-Cy7 (1:300, clone MPG-XT22, Biolegend), and anti-IFNy-PE (1:300, clone XMG1.2, Biolegend). Data were acquired on a MACSQuant®10 Analyzer (Miltenyi Biotec) and analyzed using FlowLogic software.

T memory cell response has been further analyzed. Stimulated cells were stained in FACS-PBS with anti-CD44-APC (1:5000, clone IM7, BioLegend), anti-CD8-BV421 (1:40, clone 53-6.7, BioLegend), anti-CD4-BV510 (1:40, clone RM4-5, BioLegend), anti-CD127-FITC (1:500, clone A7R34, BioLegend), anti-KLRG1-PE-Cy7 (1:80, clone 2F1, eBioscience), anti-CD127-FITC (1:500, clone A7R34, BioLegend), anti-CD69-PerCP-Cy5.5 (1:300, clone H1.2F3, BioLegend) and anti-CD103-PE (1:200, clone 2E7, eBioscience). Data were acquired on a MACSQuant®10 Analyzer (Miltenyi Biotec) and analyzed using FlowLogic software.

Viral load analysis

SARS-CoV-2 RNA quantitative real-time RT-PCR

Lung and olfactory mucosae (Etmoid turbinates of one side of the head of the hamster) biopsies were removed aseptically and frozen at −80 °C. Samples were thawed and homogenized in lysing matrix M (MP Biomedical) using a Precellys 24 tissue homogenizer (Bertin Technologies). The homogenates were centrifuged 10 min at 2000 × g for further RNA extraction from the supernatants using the RNeasy mini kit (Qiagen) following manufacturer’s instructions. SARS-COV-2 RNA quantitative real-time RT-PCR detection was further performed using the ID gene SARS-COV-2 Duplex kit (ID.Vet, Innovative Diagnostics) according to the manufacturer’s procedure. Quantitative RT-PCR was performed and analyzed using a LightCycler 96® Instrument (Roche Life Science).

SARS-CoV-2 TCID50 assay

Collected nasal swab were frozen at −80 °C in cell medium for further TCID50 assay in Vero cells. Samples were thawed and tittered using the Tissue Culture Infectious Dose 50 Assay (TCID50/ml) system. Vero cells were plated the day before infection into 96-well plates at 1.5 × 104 cells/well. On the day of the experiment, serial dilutions of the virus were made in media, and a total of six wells were infected with each serial dilution of the virus (with a starting dilution of 1:5 for the swab). After 48 h incubation, cells were fixed in 4% paraformaldehyde (PFA) followed by staining with 0.1% crystal violet. The TCID50 was then calculated using the formula: log (TCID50) = log (do) + log (R) (f + 1). Where do represents the dilution giving a positive well, f is a number derived from the number of positive wells calculated by a moving average, and R is the dilution factor.

Immunohistology

Lungs were fixed in 4% PFA 72 h and were processed for paraffin embedding, and 4–5 μm sections were used for immunohistochemistry. Half of the animal head was fixed for 3 days at room temperature in 4% PFA PBS, then decalcified for 3 days (10% EDTA–pH 7.3 at 4 °C). For mice model, immunohistochemistry was performed using anti-SARS-CoV-2 nucleoprotein antibody (1:500, GTX135357, Clinisciences). Followed by goat HistoFine anti-RABBIT (70%) and HRP revelation (DAB quanto, Thermofisher). For hamster model, the nasal septum and endoturbinates were selected as a block for convenient focus on the nasal cavity for further viral scoring following immunohistochemistry (see below). SARS-CoV-2 nucleoprotein was detected using mouse monoclonal antibody (1C7C7). The Histofine Simple Stain Mouse MAX PO kit was used as the secondary anti-mouse HRP (Nichirei Biosciences inc.). Images were captured using a Nikon Eclipse 80i microscope with DS-Ri2 camera controlled by the NIS-Elements D software package (Nikon, Instruments Inc., Tokyo, Japan).

Statistical tests

Statistical analyses were performed with Prism 7.0 (GraphPad Software, Inc.) and were done by one or two-way ANOVA or nonparametric analysis followed by a Dunn’s multiple or Kruskal–Wallis comparison tests. Results are shown as mean ± SEM (one-way ANOVA test) or as median ± interquartile range (Kruskal–Wallis test). Survival statistics were performed with the log-rank Mantel–Cox test. A p < 0.05 was considered to be statistically significant.

Source link

Get RawNews Daily

Stay informed with our RawNews daily newsletter email

Maxx Crosby Posts Emotional Farewell to Raiders After Trade to Ravens

3 FTSE 100 dividend stocks with the biggest yields. Time to buy?

Report, result and goals as Premier League side breeze into FA Cup quarter-finals

Girl Bosses of Hollywood For International Women’s Day!