Mice
C57BL/6 mice were purchased from Shanghai SLAC Laboratory Animal Co. Ltd. (Shanghai, China). LysMCre and Fasnf/f mice were purchased from the Jackson Laboratory and Cyagen Biosciences (Suzhou, China), respectively. Conditional knockout mice strain-LysMCre-Fasnf/f mice were generated by crossing LysMCre mice with Fasnf/f mice. All mice were on the C57BL/6 background. The genotypes of transgenic mice and their control littermates were confirmed by polymerase chain reaction (PCR) analysis of tail snip DNA. Mice were housed in a specific pathogen-free facility at the Laboratory Animal Center of Zhejiang University with a 12-h light/dark cycle and controlled temperature. The mice used for the experiments were 8–12 weeks old and weighed between 23 and 28 g. Mice were randomized into different groups. Male and female mice were sex-matched.
Cells
Mouse peritoneal macrophages (PMs) were harvested 4 days after thioglycolate (Merck) intraperitoneal injection and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Bone marrow cells were collected from tibias and femurs with cold DMEM and were cultured in DMEM supplemented with 10% fetal bovine serum, 10 ng/mL macrophage colony-stimulating factor (M-CSF), and 1% penicillin/streptomycin, to generate bone marrow-derived macrophages (BMDM). THP-1 cells, a human monocytic cell line, were from American Type Culture Collection (#TIB-202) and cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. For differentiation into macrophage-like cells, THP-1 cells were treated with 100 nM phorbol 12-myristate 13-acetate (PMA) for 48 h. All cells were cultured at 37 °C under an atmosphere containing 5% carbon dioxide. All cell lines were regularly tested for mycoplasma infection.
S. aureus colonization
The S. aureus strain was a clinical isolate (multilocus sequence type ST15 and agr type II) with Hld, PSMα, Hla, and PVL+++−. S. aureus was grown in Tryptic Soy Broth (TSB) medium at 250 rpm at 37 °C to mid-log phase (optical density at 600 nm of 0.6). Bacteria were collected by centrifugation at 6000 rpm for 10 min and resuspended in sterile phosphate-buffered saline (PBS). Bacteria count was quantified by serial dilutions and plating on TSB plates.
Antibodies and reagents
Primary antibodies used for immunofluorescence and western blot are as follows: anti-actin beta (ACTB) (ABclonal, #AC037), anti-FASN (Cell Signaling Technology (CST, #3180)), anti-ubiquitin (CST, #3936), anti-phosphorylated mammalian target of rapamycin (p-mTOR) (Abcam, #ab109268), anti-phosphorylated AKT (p-AKT) (Abcam, #ab38449), and anti-cathelicidin antimicrobial peptide (CAMP) (Abcam, #ab318195). Reagents as follows: C75 (#HY-12364), MG-132 (#HY-13259), rapamycin (#HY-10219), ACC inhibitor (CP-640186, #HY-15259), ACLY inhibitor (BMS-303141, #HY-16107), DGAT1 inhibitor (A922500, #HY-10038), and DGAT2 inhibitor (PF-06424439, #HY-108341), all from MedChemExpress; Oleic acid (OA) from Sigma-Aldrich (#O1383); M-CSF from Novoprotein (#CB34); and 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-inda-cene (BODIPY 493/503) from Invitrogen (#D3922). Primers for Fasn, Actb, Interleukin 6 (Il6), and Interleukin 1 beta (Il1β) were synthesized by Sangon Biotech. FASN siRNA (#sc-41516) and control siRNA (#sc-37007) were from Santa Cruz Biotechnology.
In vitro S. aureus infection
For in vitro S. aureus infection, cells were washed three times with PBS and cultured with DMEM supplemented with 10% FBS without penicillin/streptomycin. S. aureus was added at a ratio of 10 to 1 cell (multiplicity of infection (MOI) = 10), except experiments indicated.
siRNA transfection
When BMDM reached 60–80% confluence in 12-well plates, siRNA transfection was performed. For each well, 90 nM FASN siRNA or control siRNA (Santa Cruz Biotechnology) was diluted in 100 μL of Opti-MEM (Gibco, #31985070), mixed with 6 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific, #13778150), and incubated for 15 min at room temperature to allow complex formation. The mixture was then added dropwise to the cells with gentle swirling to ensure even distribution. Cells were incubated for 24 h before subsequent treatments.
Western blot analysis
Cells were lysed in RIPA lysis buffer (Beyotime, #P0013B) containing cOmplete™ Protease Inhibitor (Roche, #04693116001) and PhosSTOP™ (Roche, #04906845001). The collected samples were ultrasonicated and centrifugated at 12,000 rpm for 5 min. Protein concentrations in supernatants were measured by BCA Protein Assay Kit (ThermoFisher, #23225) and equivalent amounts of protein from each sample were added to 5× loading buffer (0.25 M Tris-Cl, 50% glycerol, 10% SDS, 2% β-mercaptoethanol, 0.25% bromophenol blue, pH 6.8). After being heated at 100 °C for 10 min, proteins were loaded and separated on 6–10% SDS-PAGE gels. Then, proteins were blotted onto PVDF membranes (Millipore, #88518). Membranes were blocked with 5% non-fat milk in TBST for 1 h at room temperature (RT) and incubated with primary antibody at 4 °C overnight. Membranes were incubated with secondary antibodies for 1 h at RT and scanned using a western blot detection system (Odyssey, Li-COR Bioscience).
Ubiquitination level of endogenous FASN protein
Cells were washed three times in cold PBS and lysed in lysis buffer (ABclonal, # RM02998) supplemented with cOmplete™ Protease Inhibitor (Roche) and PhosSTOP™ (Roche). Cell lysates were centrifugated at 12,000 rpm for 10 min at 4 °C. Cleared cell lysates were immunoprecipitated with the anti-FASN antibody (CST) at 4 °C overnight, which was pre-adsorbed on Protein G Magnetic Beads (Bio-Rad). Beads were washed three times with lysis buffer and protein samples were eluted with 1 × SDS loading buffer via heated at 100 °C for 10 min. Samples were analyzed by western blotting with the primary antibody of anti-FASN (CST) and anti-ubiquitin (CST).
RNA isolation and reverse transcription quantitative PCR (qPCR)
RNA was extracted using Trizol (Invitrogen, #15596018CN) following the manufacturer’s protocol. Reverse transcription of 1 μg of total RNA was carried out using the PrimeScript™ RT reagent Kit (Takara, #RR037A), and cDNA was synthesized. The expression of mouse Actb and Fasn were measured by Real-time qPCR on a StepOnePlus PCR system (Applied Biosystems). Data were calculated using the 2−ΔΔCt method and normalized to Actb expression. The mouse primers used for qPCR are as follows: Actb (actin beta, amplicon size 245 bp, forward GTGACGTTGACATCCGTAAAGA, reverse GCCGGACTCATCGTACTCC); Fasn (Fatty acid synthase, amplicon size 99 bp, forward AGAGATCCCGAGACGCTTCT, reverse GCTTGGTCCTTTGAAGTCGAAGA); Il6 (Interleukin 6, amplicon size 131 bp, forward CTGCAAGAGACTTCCATCCAG, reverse AGTGGTATAGACAGGTCTGTTGG); Il1β (Interleukin 1 beta, amplicon size 116 bp, forward GAAATGCCACCTTTTGACAGTG, reverse TGGATGCTCTCATCAGGACAG).
Immunofluorescence analysis
Cells were seeded at a density of 2 × 105 cells per well in 12-well plates and treated as indicated. After washing twice with PBS, the cells were fixed in 4% paraformaldehyde in PBS for 15 min at RT and washed three times with PBS. Then, cells were permeabilized with 0.5% Triton X-100 and blocked with 5% bovine serum albumin in PBS. For immunostaining, cells were incubated with primary antibodies overnight at 4 °C, followed by incubation with secondary antibodies conjugated to Alexa Fluor 488 or 555 (Life Technologies) for 1 h at RT in the dark. DAPI was used to stain the nuclei. For lipid droplet staining, cells were incubated with a 2 µM Bodipy 493/503 at 37 °C for 15 min in the dark, followed by DAPI staining. Images were visualized using a high-resolution laser Confocal Microscope (Olympus IX83-FV3000-OSR) and processed with FV31S-SW software (Olympus).
ELISA
Cytokine levels in the supernatant of bronchoalveolar lavage fluid (BALF) were measured using Mouse interleukin 6 (IL6) DuoSet ELISA (R&D Systems, #DY406) and Mouse CXC motif chemokine ligand 1 (CXCL1) DuoSet ELISA Kit (R&D Systems, # DY275) according to the manufacturer’s instructions. Absorbances at 450 nm were measured on a VersaMax microplate reader (Molecular Devices). Cytokine concentrations were calculated by extrapolating absorbance values from standard curves where known concentrations were plotted against absorbance.
Flow cytometric analysis
Cells were centrifuged at 400 × g for 5 min at 4 °C and resuspended in 50 µL of PBS. To evaluate cellular lipid level, cells were suspended in Bodipy 493/503 and protected from light for 30 min at 37 °C. Finally, cells were assayed using a FACSCalibur flow cytometer (Cytoflex) and analyzed with FlowJo software (version 10; Tree Star).
Transmission electron microscopy
Macrophages were fixed in 2.5% glutaraldehyde for 1 h at RT, followed by overnight fixation at 4 °C. After three washes with PBS, the cells were post-fixed with 1% osmium tetroxide in PBS for 1.5 h and subsequently stained with 2% uranyl acetate. The samples were dehydrated through a graded ethanol series and embedded in resin. Ultrathin sections were cut, stained with 1% uranyl acetate and 0.4% lead citrate, and imaged using a transmission electron microscope (Tecnai G2 Spirit 120 kV) at the Centre of Cryo-Electron Microscopy, Zhejiang University.
Proteasome activity detection
The proteasome activity of cells was detected by the Proteasome 20S Activity Assay Kit (Sigma-Aldrich, #MAK172) according to the manufacturer’s instructions. The fluorometric signals were detected on SpectraMax® M5/M5e Multimode Plate Reader (Molecular Devices).
LD purification
LD purification was performed by Lipid Droplet Isolation Kit (Cell Biolabs, #MET-5011). Briefly, cells were incubated with 120 µM OA for 12 h to induce LDs which were then resuspended pellet thoroughly with 200 µL of Reagent A. They were incubated on ice for 10 min. Then 800 µL of Reagent B was added and mixed well. Cells were homogenized by passing them five times through a one-inch 27 gauge needle attached to a 3 mL syringe. Reagent B was loaded on top of the homogenate. Ultracentrifugation with 18,000 × g at 4 °C was performed for 3 h so that the LD fraction would be at the top of the tube.
LD proteomic analysis
LDs were isolated from macrophages treated with OA or OA plus S. aureus, and subjected to protein extraction using 8 M urea supplemented with protease inhibitors. Proteins were reduced with 10 mM TCEP, alkylated with 25 mM CAA, and digested overnight with trypsin (50:1, w/w) in 10 mM TEAB at 37 °C. Peptides were acidified with formic acid, desalted using C18 columns, eluted with 70% acetonitrile, lyophilized, and stored at –80 °C. Peptides were analyzed on a Q Exactive HF-X mass spectrometer (Thermo Fisher Scientific) using a C18 column and data-dependent acquisition. MS data were processed with Proteome Discoverer (v2.4) and searched against the Mus musculus UniProt database using Sequest HT. Search parameters included trypsin digestion (≤2 missed cleavages), 15ppm precursor tolerance, 0.02 Da fragment tolerance, fixed carbamidomethylation (C), and variable oxidation (M). Peptide and protein FDRs were set at
Bacterial load measurement
For supernatants of cell culture, supernatants were centrifugation at 6000 rpm for 10 min at 4 °C, and bacterial pellets were resuspended in sterile PBS. After serially diluted in PBS, samples were plated on TSB plates and incubated at 37 °C overnight. The colony-forming units (CFUs) were enumerated.
For lung tissues, the left lungs were homogenized in sterile PBS. Homogenates were serially diluted in PBS and plated on TSB plates. After incubating at 37 °C overnight, CFU was enumerated.
Phagocytosis assay
The phagocytosis rate was detected by a phagocytosis assay kit (Red Zymosan) (Abcam, # ab234054). Briefly, cells were washed three times with PBS and incubated with Red Zymosan at 37 °C for 1 h. Cells were harvested by centrifugation at 400 × g for 5 min and resuspended in PBS. Fluorescence signals were acquired on a CytoFlex analyzer (Beckman Coulter) at Ex/Em 540/570 nm and data were analyzed using FlowJo software (version 10; Tree Star).
Scratch wound healing assay
For evaluating macrophage migration, scratch wound healing assay was employed. Confluent BMDM monolayers in 6-well plates were scratched using a 200 µL pipette tip. After washing with PBS, cells were treated with DMSO and C75 in DMEM with 2% FBS. Images were captured at 0 and 24 h, and scratch length was quantified using ImageJ software.
Cell adhesion assay
For cell adhesion assays, THP-1 cells were differentiated with 100 nM PMA for 48 h. The wells of a 24-well plate were coated with 0.1% gelatin and incubated overnight. Cells (1 × 105 per well) were plated and allowed to adhere for 1 h at 37 °C. After washing with PBS, adherent cells were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet.
Murine bacterial infection
For murine bacterial infection, age-matched 8-10 week-old mice, weighing between 23 and 28 g, were studied, and 5 × 106 S. aureus in 50 µL sterile saline was intratracheally inoculated per mouse. Control animals were intratracheally infused with 50 µL sterile saline only. For lethal infections in the survival curve analysis experiment, 1 × 108 S. aureus in 50 µL sterile saline was intratracheally inoculated per mouse. Mice were monitored twice daily for mortality.
Bronchoalveolar lavage
Twenty-four hrs after bacterial lung infection, mice were sacrificed for analysis. BALF was collected by instilling 1 mL PBS into the left lung through the trachea. The total BAL cells were counted, and the rest of the BALF was centrifuged at 400 × g for 15 min at 4 °C. Then the cell types in the BALF were identified based on Wright-Giemsa staining. Cytokine levels in supernatants were determined by ELISA (R&D Systems) as described previously.
Lung histology
Lung tissue was fixed in a 10% formalin solution and embedded in paraffin. Lung sections were cut and stained with hematoxylin and eosin (H&E) or subjected to gram stain by the Histopathology Core Platform of Zhejiang University School of Medicine. Images of lung sections were visualized on an Olympus BX53 microscopy. The inflammation score was assessed on a subjective scale of 0-3 based on published guidelines [23].
RNA sequencing data analysis
RNA-seq data were retrieved from the Gene Expression Omnibus (GEO) database (GSE272198) [24]. Differential expression analysis was performed using DESeq2 (V1.42.1), with upregulated genes identified based on an adjusted P-value 2 fold change > 0. These upregulated genes were subsequently subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis using the ClusterProfiler package (V4.12.6) in R. The top 20 enriched KEGG pathways were visualized using a bubble chart to highlight the most relevant biological processes. In this chart, the x-axis represents the gene ratio, calculated as the number of upregulated genes mapped to a given pathway divided by the total number of upregulated genes analyzed; the bubble size (“count”) reflects the number of upregulated genes enriched in each pathway; and the y-axis displays the statistical significance of pathway enrichment, expressed as the negative logarithm of the adjusted p-value [−log10(p value)], where a higher value indicates stronger enrichment.
Statistics
Sample sizes were determined based on preliminary experiments and previous publications. No samples were excluded from the analysis. Animals were randomly assigned to experimental groups where applicable. The investigator was blinded to group allocation during histological assessment, but blinding was not applied for other analyses. Data were tested for normality and presented as the mean ± standard error of the mean (SEM). For comparisons between two groups, an unpaired two-tailed Student’s t test was used. Comparisons among multiple groups were conducted using one-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons. For experiments involving two independent variables, two-way ANOVA was performed with Sidak’s post-hoc test. Kaplan–Meier survival curves were generated, and survival differences between groups were evaluated using the log-rank (Mantel–Cox) test. All statistical analyses were performed using GraphPad Prism 8 software. Differences were considered statistically significant when the P value was less than 0.05. The raw experimental data for all comparisons have been provided in Supplementary Table 1.