Stock Ticker

Coronaviruses in diarrheic pigeons and the first determination of the complete genome of a new pigeon gammacoronavirus

Ethics statement

The protocols for this study were reviewed and approved by the Local Ethics Committee on Animal Experimentation of University of Warmia and Mazury (UWM) in Olsztyn, Poland (resolution No 41/2019). All sampling was undertaken during a standard clinical examination of birds being patients of Department of Poultry Diseases, Faculty of Veterinary Medicine, UWM in Olsztyn, Poland. Permission was obtained from the owners to collect cloacal swab samples from the pigeons and to use them in the study. The fecal samples, used for qualification of birds for the study, were provided by the owners. The sampling was non-invasive and all pigeons were alive and unharmed after the sample collection. All methods were carried out in accordance with relevant guidelines and regulations and are reported in accordance with ARRIVE guidelines.

Sample collection

The qualification of pigeons for sampling is described in detail by Łukaszuk et al.16,17. Cloacal swab samples were collected from 90 pigeons originating from 24 flocks in which signs of enteric disease were recently observed (study group) and from 63 healthy pigeons originating from 13 flocks without recent outbreaks of disease (control group). All pigeons tested were under 1 year of age and free of pathogenic bacteria, fungi and/or parasites based on fecal examination. After the sampling, the individual swabs were submerged in universal liquid transport medium for viruses as well as chlamydia, mycoplasma and ureaplasma (Copan Diagnostics, Murrieta, California, USA) and the medium was further divided into two parts and stored at − 80 °C until the analysis.

Sequencing and bioinformatic analyses

Oxford nanopore sequencing

One half of the transport medium was enriched for viral particles by filtration with 0.8 µm polyethersulphone spin filters (Sartorius, Goettingen, Germany) and subjected to nuclease treatment and nucleic acid extraction. The DNA and RNA libraries were generated as previously described18,19,20. The libraries were run on Oxford nanopore GridION X5 sequencer with a R9.4.1 flow cell in combination with Rapid Barcoding Kit SQK-RBK110-96 used for library preparation (Oxford Nanopore Technologies Ltd., Oxford, United Kingdom) for 24 h. Oxford Nanopore Sequencing was performed in PathoSense laboratory (Oxford Nanopore Technologies Certified Service Provider, Merelbeke, Belgium).The resulting raw reads were transformed to bases with Guppy v7.1.4 and in-house bioinformatic pipelines were used to quality filter and taxonomically classify the sequences. As a final step, the viral genomic sequences, from each classified taxon separately, were de novo assembled with Canu v2.221 and Medaka v1.4.1 tools (Oxford Nanopore Technologies Ltd., Oxford, United Kingdom). BLASTx22 was used to identify viral-like sequences against the Viral RefSeq protein database (release 210) downloaded from GenBank database (NCBI). The raw reads were mapped to the consensus virus genomes using Minimap2 v. 0.2-r12323. This mapping was subsequently examined and any discrepancies in the mapping and corrected as necessary.

Genome annotation and phylogenetic analyses

Open reading frames (ORFs) were determined in the coronavirus sequence with Find ORFs tool and annotated with Annotate by BLAST tool, both available in the Geneious Prime software v. 2025.0.3 (Dotmatics, Boston, Massachusetts, USA). The putative locations of conserved domains in replicase polyprotein were identified based on alignment with other avian coronavirus sequences (M95169, EU095850, MK359255 and KM454473). Using the BLAST search22 we identified similar sequences in the GenBank database (NCBI). In this manner, two gammacoronavirus sequence datasets were created – one composed of complete genomic sequences and the second of complete and partial sequences of varying length, including RNA-dependent RNA polymerase (RdRp) fragment. The sequences in both sets were aligned with MAFFT method24 and those in the second set were trimmed to the length of the shortest sequences and translated to amino acids, all in Geneious Prime software. The sets were then used to generate pairwise identity matrices with SDT v1.3 software25. Then, maximum likelihood phylogenetic trees using substitution models deemed most appropriate with Find DNA/protein models tool in MEGA 11 software26 were inferred with 1000 bootstrap replicates using IQ-TREE 1.6.12 software27,28. The phylogenetic trees were visualized with iTOL v6 software29. Finally, the newly obtained and annotated complete sequence of pigeon gammacoronavirus was deposited in GenBank (NCBI) under accession number PQ679936.

Recombination analysis

RDP5 software was used to identify any evidence of recombination with default parameters and the following methods: RDP, GENECONV, BOOTSCAN, MaxChi, Chimaera, SiScan, and 3SEQ30,31,32,33,34,35,36,37. Only recombination events detected by a minimum of three methods with p < 0.05 coupled with phylogenetic support were determined to be plausible.

Quantitative analysis

RNA extraction and reverse transcription

RNA was extracted from the second part of the transport medium using Total RNA Mini Plus kit (A&A Biotechnology, Gdańsk, Poland) according to manufacturer’s instructions. The extracted RNA was eluted in 50 μl of nuclease-free water prior to determining the purity and concentration using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Then, cDNA was synthesised by performing reverse transcription with 8 µl of RNA and 2 µl of 5X PrimeScript RT Master Mix (Takara Bio, Kusatsu, Japan). Finally, the samples were frozen at − 80 °C until analyzed further.

TaqMan quantitative PCR

A TaqMan qPCR assay was developed to test the samples for presence of pigeon gammacoronavirus. Primers (forward: 5′-ATGTAAAGCCTGGTGGGACT-3′ and reverse: 5′- AGACGCGCAACATTAGCTGA-3′) and probe (5′-[HEX]TGGTGATGCCACAACTGCTT [BHQ-1]-3′) were designed with Design New Primers tool available in Genious Prime software, using the sequence determined in this study as well as sequences acquired from GenBank: OM366031, OM366013, MK617492, KP033084 and KT222633. The assay targets a 100 bp fragment of RdRp gene. The reaction mixture was prepared by mixing 10 µl of TaqMan™ Fast Universal PCR Master Mix (Thermo Fisher Scientific, Waltham, Massachusetts), 1.8 µl of both 10 µM primers, 2 µl of 2.5 µM probe, 1.4 µl of nuclease-free water and 3 µl of cDNA. The conditions of the reaction carried out in the LightCycler® 96 System thermocycler (Roche, Basel, Switzerland) were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 15 s and 59 °C for 40 s.

Specificity and sensitivity of the developed assay was assessed before testing the samples. To assess the specificity, the reaction was run on samples containing genetic material of other known pigeon viruses, such as pigeon rotavirus A (PP849436), pigeon astrovirus (PP478075), pigeon picornavirus B (PP735155) and megrivirus B (PP735150), as well as other avian coronaviruses, including infectious bronchitis virus (mass-like strains and variant strains) and gull deltacoronavirus. The coronavirus strains were kindly provided by Prof. Katarzyna Domańska-Blicharz (National Veterinary Institute, Puławy, Poland) and the other strains originated from the collection of Department of Poultry Diseases, Faculty of Veterinary Medicine, UWM in Olsztyn, Poland.

The sensitivity was determined based on a standard curve of a control we developed as follows. Using Geneious Prime software, we designed primers (forward: 5′-TGTCTTGCCCACCATAACTCAG-3′ and reverse: 5′-AACCCAGCACTTTGAGTCG-3′) targeting a 802 bp fragment that spans the qPCR assay region. The reaction mixture consisted of 10 μl of HotStar TaqPlus DNA Polymerase (Qiagen, Hilden, Germany), 0.1 μl of both 100 μM primers, 6.8 μl of nuclease-free water and 3 μl of pigeon coronavirus cDNA. The PCR reaction was carried out in a Mastercycler thermal cycler (Eppendorf, Hamburg, Germany) with the following thermal cycling conditions: 95 °C for 5 min, 40 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 1 min, then 72 °C for 10 min. The resulting amplicons were purified using the Clean-Up kit (A&A Biotechnology, Poland) and NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA) was used to determine the concentration and purity. The gene copy number was calculated with a copy number calculator (Genomics and Sequencing Center, University of Rhode Island, Kingston, Rhode Island). Finally, TaqMan qPCR was performed with series of decimal dilutions from 3.7 × 107 to 3.7 × 103 copies of the amplicon/μl used as a template, and all samples were tested in triplicate.

The proper testing of the samples was then conducted, using a sample from the collection of Department of Poultry Diseases, Faculty of Veterinary Medicine, UWM in Olsztyn, Poland as a positive control (OM366031). All samples were tested in duplicate and those with Cq of 35 or less were considered positive.

Droplet digital PCR

To directly quantify the loads of pigeon gammacoronavirus in samples positive by TaqMan qPCR, we developed a droplet digital PCR (ddPCR) method, using the same primers, probe and positive control as for qPCR. First, 22 μl of reaction mixture was prepared by mixing 11 μl of ddPCR Supermix for Probes, 1.98 μl of both primers and 2.2 μl of probe, 1.84 μl of RNase-free water and 3 μl of cDNA. Next, droplet emulsions were prepared in the same way as in our previous studies16,17. Then, the reaction was performed in a C1000 Touch Thermal Cycler (Bio-Rad laboratories) and the conditions were as follows: 95 °C for 10 min, 40 cycles of 94 °C for 30 s and 50 °C for 1 min, and 4 °C for 30 min; every step had a ramp rate of 2 °C/s. QX 200 Droplet Reader was then used to calculate the number of coronaviral amplicons in the droplets. All reagents and devices used for ddPCR were manufactured by Bio-Rad (Hercules, California, USA). Resulting counts were presented as mean number of viral genome copies ± standard deviation per 20 µl of the sample, and in the case of samples diluted prior to ddPCR, the values were multiplied by the dilution value.

Statistical analysis

Based on expected values, V-square test (V2) was deemed the most appropriate to assess the correlation between the detection rate of the virus and the health status of the pigeons. As for the correlation of the amount of viral genetic material in the positive samples with the health status of the pigeons, it was tested using Mann–Whitney U non-parametric test. Differences were considered significant with P < 0.05 and the analyses were done in Statistica 13 software (Statsoft, Cracow, Poland).

Source link

Get RawNews Daily

Stay informed with our RawNews daily newsletter email

Liverpool defender left out of World Cup squad

Madonna Covering Rent For Musicians Working At Her Old NYC Rehearsal Space

Up 16.5%! Here’s why Hollywood Bowl stock smashed the FTSE 250 today

Trump says Iran would not get sanctions relief in exchange for giving up enriched uranium